1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ki77a [65]
2 years ago
12

What is greenhouse gas?

Biology
1 answer:
Ksju [112]2 years ago
5 0

Answer:

d

Explanation:

I don't know, I'm just assuming

You might be interested in
How old are the oldest rocks of the ocean floor?
algol [13]
Oceanic crust has been forming on Earth for over 4 billion years, all of the sea floor older than <span>about 200 million years. </span>
4 0
3 years ago
What does the left hemisphere of the brain do?​
aniked [119]

Answer:

The left side of the brain is responsible for controlling the right side of the body. It also performs tasks that have to do with logic, such as in science and mathematics.

Explanation:

Basically controls the opposite side of your brain and used for brain intensive tasks.

6 0
3 years ago
Enzyme and substrate concentration<br> 4.<br> *RECALL: What is a substrate?
Alona [7]

Explanation:

base on which an organism lives the soil is the substrate of most seed plants. .A substance acted upon (as by an enzyme)

6 0
2 years ago
The placement of prokaryotes into major clades within the domains Archaea and Bacteria has been based on __________.
Alja [10]

Answer:

Molecular evidence

Explanation:

Earlier archaea were considered as bacteria because they show some similarities with bacteria like binary fission as mode of reproduction, lack of a nucleus, etc.

Later Carl Woese separated bacteria in a different domain and divide prokaryote into two domains called bacteria and archaea. He separated archaea from bacteria on molecules evidence.

He compaired rRNA sequence between bacteria and archaea and observed that they both differ in rRNA sequence which allowed him to make a separate domain for archaea.

6 0
3 years ago
Using the first initial of each word in the Word Bank, list the order of the levels of classification, starting with the broades
Marrrta [24]
DKPCOFGS is the order
4 0
3 years ago
Other questions:
  • What differences were observed between Dutch and Pakistani infant populations that received the rotavirus vaccination? Select th
    8·1 answer
  • Some bears kept in captivity allow veterinarians to routinely give them total body checkups. these bears open their mouths for t
    15·1 answer
  • Gastrin, histamine, endorphins, serotonin, cholecystokinin, and somatostatin are hormones or paracrines that are released direct
    9·1 answer
  • A(n) _____ specimen is the most concentrated urine.
    8·1 answer
  • The process of protein building begins with what molecule?
    13·2 answers
  • Why is photosynthesis referred to as a biochemical pathway?
    13·2 answers
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • What are two major parts of compound microscope?​
    13·2 answers
  • Why the pulmonary arteries have light violet blood?​
    5·1 answer
  • What do the Neuron and Epithelial Cells have in common?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!