1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Thepotemich [5.8K]
2 years ago
11

Explain how structure of cell wall in xylem tissue enables it to be strong and flexible?

Biology
1 answer:
Drupady [299]2 years ago
8 0
The walls of xylem cells are lignified (strengthened with a substance called lignin ). This allows the xylem to withstand pressure changes as water moves through the plant.

The cell membrane is flexible because of the presence of oil like substances called phospholipids, which gives it a fluid nature. While as the cell walls are rigid because of the presence of the thick layers of the substances like cellulose in plants, chitin in fungi and peptidoglycon in bacteria.
You might be interested in
Regrowth of grass, ferns, wildfloeers after a wildfire is an example
ss7ja [257]
Regeneration reproduction It grow back regrowth
4 0
3 years ago
Avery started feeding her dog canned food two months ago. At first, when she opened the can of food, her dog was confused by the
Alenkasestr [34]
The appropriate response is classical conditioning. It is a learning procedure that happens when two boosts are over and over combined; a reaction that is at first inspired by the second jolt is at the end evoked by the primary jolt alone. Classical conditioning is the essential learning procedure, and its neural substrates are presently starting to be caught on.
3 0
3 years ago
Will give 11 POINTS IF YOU ANSWER PLEASE
cestrela7 [59]

parents,animals ,plants

8 0
3 years ago
I just need the right words for each place. (8-10)​
uysha [10]
8. Glucose
9. NADH
10. 2 Pyruvic Acid
8 0
3 years ago
In sexually reproducing multicellular organisms, the main functions of mitosis are _____. Check all that apply.
nasty-shy [4]

Answer:

b)repair/replacement of damaged cells growth and development

Explanation:

Mitosis is a process of cell division that has many purposes. In individuals of sexual reproduction such as humans, mitosis is responsible for multiplying cells during the embryonic development; through this process the zygote (unicellular) is transformed into a multicellular organism. Additionally, mitosis allows the formation of new cells for tissue growth and to replace worn out cells.

The cell division that allows the gamete production for reproduction is a different process called meiosis.

3 0
3 years ago
Other questions:
  • In the steps of the scientific method, what is the process where a scientist writes down tentative explanations or statements ab
    13·1 answer
  • Before the age of 4 months, an infant is likely to spit out semisolid foods because of:
    7·1 answer
  • The Ngas believed without the<br> there would be no life.
    10·1 answer
  • Each of the following is a main idea of the cell theory except
    9·1 answer
  • A complete pathway through the nervous system, beginning with a stimulus and ending with a response, is called a/n:
    6·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Rainfall collects in a crack in a rock. When the temperature drops, this water freezes and expands. This causes the crack to bec
    14·2 answers
  • (1 point)
    11·1 answer
  • Which of the following doesn't consist of cells?
    13·2 answers
  • If pathogen A is more resistant to an erythromycin disc on a Kirby-Bauer plate compared to pathogen B, then pathogen A will have
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!