1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
puteri [66]
3 years ago
12

What is the function of the immune system?

Biology
2 answers:
irga5000 [103]3 years ago
7 0
To fight off infections in the body, it is also responsible for Making your white making your white blood cells
Bas_tet [7]3 years ago
6 0

Answer: it helps with saving you form getting sick !!

Explanation:

You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Select all options that are CARNIVORES (organisms who get energy by eating ONLY animals/meat). *
Elis [28]
Lion whales cheetah tiger shark
3 0
3 years ago
A certain restriction enzyme cleaves double-stranded DNA at the sequence shown below, where the slash indicates where each stran
nydimaria [60]
I don’t know what you are asking
5 0
3 years ago
A(n) ____________ reaction occurs when the bonds of the reacting compounds are broken and new combinations are formed.
Step2247 [10]
An Exchange reaction
8 0
3 years ago
the solution inside a plant cell is approximately a 1% saline solution. in a 25% nacl solution the cytoplasm of a plant cell wil
mrs_skeptik [129]
<span>The cell has 1% concentration of the salt. The external environment is highly concentrated with 25% saline solution. This will lead to release of water outside the cell, by passive diffusion from a region of high conentration of solvent to lower concentration. Thus, the cell will shrink.</span>
3 0
3 years ago
Read 2 more answers
Other questions:
  • There are many factors that influence the number of different kinds of plants in a biome. Why is elevation, or height, a factor
    8·1 answer
  • Which of the following provides the best example of how comparative embryology supports the theory of evolution? A. Humans do no
    14·1 answer
  • Can anyone explain the development stages of foetus in ownwords/understanding?
    11·1 answer
  • Most recently, the classification of life on Earth was changed. The research leading to this change is also the same research th
    10·1 answer
  • the tuco toucan, the largest member of the tucan family, possesses the largest beak relative to body size of all birds. This exa
    15·1 answer
  • Artificial selection only produces favorable results
    11·1 answer
  • Please answer ASAP (:
    8·1 answer
  • Hayley woke up to a hot and humid day but knows it is going to cool off later. What should she expect the weather to be like ton
    11·1 answer
  • Explain how branching tree diagrams show evolutionary relationships among species
    13·1 answer
  • Solution to improve the human diet based on the concept of anaerobic respiration​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!