Answer:
The possible letters are A, C, G, and T, representing the four nucleotide bases of a DNA strand — adenine, cytosine, guanine, thymine — covalently linked to a phosphodiester backbone.
Explanation:
I believe that in developed nations, the nutrients that are most lacking in a child's diet are the; calcium, iron and zinc. Zinc is needed for the activity of more than 100 different enzymes in the body and plays a role in the immune function. It aids in the maintenance of healthy immune function in kids and may reduce the frequency of mild upper respiratory tract infections. Calcium keeps the bones healthy and teeth thus supporting the skeletal structure and function. Iron is an important component of hemoglobin.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
cause an increase in the rate of certain mutations
Answer:
The crust
Explanation:
The solid, outer layer is called the crust.
