1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
dezoksy [38]
3 years ago
8

Explain how a persons DNA can determine whether or not he has hemophilia

Biology
2 answers:
Elina [12.6K]3 years ago
4 0
Without this protein, stable clots do not<span> form quickly over wounds. Weak. clots form, but they are easily dislodged, so that people with </span><span>hemophilia can.</span>
Artyom0805 [142]3 years ago
3 0
Hemophilia would be a disorder is a DNA sequence, which is why its detectable upon examination of DNA 
You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
Enlist the significance of reproduction
Naddik [55]
To ensure the continuity of the species
increase variation in species for natural selection to occur
7 0
3 years ago
Read 2 more answers
Could someone help me with this please
ololo11 [35]

Answer:

3

Explanation:

7 0
3 years ago
Read 2 more answers
50 POINTS Use the library and other reference materials to research lupus. Then, write a 400 word report on what you have learne
mario62 [17]

Answer:

Symptoms of Lupus disease are inflammation, swelling, damage to the joints, skin, kidneys, heart, and lungs etc

Explanation:

Lupus refers to autoimmune disease in which the immune system of the body  attacks its normal and healthy tissue instead of virus and bacteria. Symptoms of this disease include inflammation, swelling, and damage to the joints, skin, kidneys, heart, and lungs etc. The main cause of this disease is the environment which trigger Lupus. Chemotherapy and medications such as Nonsteroidal anti-inflammatory drugs and Antimalarial drugs etc are used for its treatment.

3 0
3 years ago
The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on app
Free_Kalibri [48]

Answer:

it is 736

Explanation:

me big brain

7 0
3 years ago
Other questions:
  • The midpiece of the mature sperm contains mitochondria that provide metabolic energy for the trip to the egg. fructose (simple s
    12·1 answer
  • Two types of spiral galaxies exist. A normal spiral galaxy is one kind. Which phrase best describes the second type of spiral ga
    5·1 answer
  • PLEASE HELP ITS 18pts
    12·1 answer
  • Which statement best summarizes Gregor Mendel's contribution to science? Question options:
    14·2 answers
  • Jovian planets _____.
    9·2 answers
  • A dog breeder mates a homozygous brown dog (BB) with a homozygous white dog (bb) and all of the puppies are brown (Bb). These pu
    6·2 answers
  • What happens when ethanol combusts?
    13·1 answer
  • Enumerate ways on how humans produce sound:Ex:clapping your hands
    11·2 answers
  • As Marcus walks through the forest after a rainstorm, he notices bubbles forming in the cracks of some rocks. Which of the follo
    15·1 answer
  • Help please with 4 super easy
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!