1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
2 years ago
7

What is

Biology
1 answer:
Alinara [238K]2 years ago
7 0

Answer:

"the act of placing multiple text elements side by side to compare them"

Explanation:

the definition of juxtaposition is "the fact of two things being seen or placed close together with contrasting effect."

You might be interested in
explain why a father with blood group AB cannot donate for a child with blood group O when he marries a woman with blood group O
denis-greek [22]

The odds are astronomical for a father with AB(IV) to have an O(I) child. The only possible way for this phenomenon to occur is if there was a nondisjunction in the ovogenesis for the 9th chromosome and the father also had a nondisjunction for the same chromosome(A sperm cell with no 9th chromosome fertilized an ovum with two 9 chromosomes).

A person with AB cannot donate to a person with O because the receiver has antibodies(alpha and beta) that bind to the antigens on the AB blood cells, causing death.

7 0
3 years ago
How many phosphate minerals most affected human activity
goldenfox [79]

Answer:

How much phosphorus does the human body have?

How much phosphorus do I need?

Life Stage Recommended Amount

Children 9 to 13 years old 1,250 mg

Adolescents 14 to 18 years old 1,250 mg

Pregnant and lactating adolescents 1,250 mg

Adults over 19 years of age 700 mg

Explanation:

3 0
2 years ago
HELPP me please I’ll give brainliest if two people answer!!!!
Mazyrski [523]
A is the Stigma and B is the Style

The stigma is part of a pistil Where pollen germinates and it provides receptacle pollen

The style is is where pollen deposits
4 0
3 years ago
What do we call a sybiotic relationship that is good for both species involved in it?
Tamiku [17]
Mutualism is the symbiotic relationship that is good for both species involved as both species benefit
5 0
3 years ago
If a nerve cell stopped functioning, the cell would
AnnyKZ [126]

Answer:

stop sending signals to the brain

Explanation:

4 0
3 years ago
Read 2 more answers
Other questions:
  • What plant family is coffee from?
    12·1 answer
  • Which dna sugar phosphate bases connect with each other
    14·1 answer
  • What is the basic function of catabolic operons like the lac operon?
    10·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Punnet square with brown eyes and blue eyes
    6·1 answer
  • Please help !!! Explain how a change in an abiotic factor, such as sunlight, would affect biodiversity.
    13·2 answers
  • 1. Which statement is true?
    9·2 answers
  • Does anyone know the answers
    6·1 answer
  • Diagnostic test that measures electrical activity within muscle fibers.
    15·1 answer
  • PLEASE ANSWER QUICK
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!