1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Doss [256]
2 years ago
8

Choose the appearance of a liquid in the kettle that is heated to simmer.

Biology
1 answer:
ruslelena [56]2 years ago
7 0

Answer:

The liquid in the kettle will be simmering if it is just below the boiling point. The liquid will be hot, but not boiling, and there will be bubbles rising to the surface.

Explanation:

You might be interested in
Which term refers to the energy that is stored or released during a change of state of water? evaporation heat caloric heat ultr
Anon25 [30]

It's latent heat.

Caloric heat and ultraviolet heat have nothing to do with water changing state, and I don't think 'evaporation heat' is even a thing. Hope this'll help.

6 0
3 years ago
A greater stability of the biosphere would most likely result from
mars1129 [50]

Answer:

C

Explanation:

Increased biodiversity helps diminish reliance on one species

5 0
3 years ago
Jessica isn't invited to a super bowl party her coworkers are throwing because she's a woman. jessica is experiencing ____ from
Dahasolnce [82]
The answer is A. Discrimination

I hope this helps!
8 0
3 years ago
Read 2 more answers
The two processes that move the most amount of carbon through the carbon cycle are? a.photosynthesis and respiration b. decompos
goblinko [34]

Answer:

Photosynthesis and Respiration

Explanation:

In photosynthesis C is used in the form of CO2.

In respiration C is released in the form of CO2.

7 0
3 years ago
What is an example of a prokaryotic organism?<br> BACTERIA<br> ALGAE<br> MUSHROOM
Papessa [141]

Answer:

<em>the</em><em> </em><em>example</em><em> </em><em>of</em><em> </em><em>prokary</em><em>otic</em><em> </em><em>organism</em><em> </em><em>is</em><em> </em><em>bacter</em><em>ia</em>

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which shotgun choke is best for hunting a large, slow bird, such as a t?
    13·1 answer
  • Under which condition is competition among lions least likely?
    11·2 answers
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • What can you do if the bicyclist moves into your path of travel?
    9·1 answer
  • The part of the neuron whose name literally means "branch" is a(n)
    15·1 answer
  • A specialized fleshy stem used for food storage and reproduction is a _____. a.)corm
    11·1 answer
  • What is study of plants called?
    5·2 answers
  • In this lab, you are only looking at eukaryotic cells, plants are one type of eukaryote that you will be looking at. What are 2
    7·1 answer
  • Which one of the causes of
    7·1 answer
  • How has aids affected the people in Nairobi
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!