Hi
The answer is : Somatic
Because somatic relating to the body
I hope that's help:-
Good luck honey! you got this :) and if you fail i’m still proud of you
Answer:
A. 50, 88, 145, 227
Explanation:
The correct option would be option A.
<u>When something grows exponentially, it means the growth increased at a high rate. More specifically, each rate of increase results in more or less doubling of the preceding rate. For example, if the current value of growth rate is 2 for a substance that is growing exponentially, the next growth rates will be 4, 8, 16, etc.</u>
<em>In this particular illustration, the only option that best fit into an exponential system is option A in which the growth rate more or less doubles each time from 50 to 88, from 88 to 145, and then from 145 to 227.</em>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
