1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jasenka [17]
2 years ago
5

Shiga toxin kills cells by preventing protein synthesis. a. true b. false

Biology
1 answer:
MissTica2 years ago
5 0
The answer is false
You might be interested in
When a solid changes dirictly into a gas a change called occures
algol [13]

Sublimation, i think so

3 0
3 years ago
Read 2 more answers
Which statement describes a process associated with meiosis?
loris [4]

Answer:

c

Explanation:

7 0
2 years ago
Which land biome has the greatest diversity of plant species
klasskru [66]
Tropical rainforests 
5 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
The successful infection of a host, and subsequent spread to another, results from a specific sequence of events known as the re
Digiron [165]

Answer:

gggggghgh

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • How might monitoring faults help geologists predict an earthquake
    13·1 answer
  • How are dry climate regions identified?
    10·2 answers
  • Which is an example of a technological factor influencing food choices?
    14·1 answer
  • How do glaciers erode by abrasion?
    11·1 answer
  • In the illustration, whitch site is an example of a trench?
    10·2 answers
  • What type of limiting factor is space
    12·1 answer
  • Which organism is the primary producer<br> 1)Grass<br> 2)mushroom<br> 3)snake<br> 4)eagle
    10·2 answers
  • Help me please. Please.
    14·1 answer
  • consider a stable frog population living at carrying capacity in a pond. an average female produces 6,000 eggs during her lifeti
    8·1 answer
  • These antibiotics include penicillin and its derivatives and work by inhibiting the production of the bacterial ____________ .
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!