1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DiKsa [7]
2 years ago
13

Single-cell damagenome profiling unveils vulnerable genes and functional pathways in human genome toward DNA damage

Biology
1 answer:
exis [7]2 years ago
5 0

We report a unique unmarried-cellular complete-genome amplification method (LCS-WGA) which could correctly seize spontaneous DNA damage existing in single cells. We discuss with those harm-related single-nucleotide editions as "damSNVs," and the entire-genome distribution of damSNVs because the damagenome.

We discovered that during unmarried human neurons, the damagenome distribution turned into significantly correlated with three-dimensional genome structures.

This nonuniform distribution shows extraordinary ranges of DNA harm effects on special genes. next, we identified the functionals that have been considerably enriched within the excessive-damage genes.

comparable functionals had been also enriched in the differentially expressed genes (DEGs) detected by unmarried-mobile transcriptome of both Alzheimer's sickness (advert) and autism spectrum disorder (ASD). This result can be defined with the aid of the sizeable enrichment of excessive-harm genes in the DEGs of neurons for both ad and ASD. the discovery of excessive-harm genes sheds new lighting fixtures on the critical roles of DNA harm in human sicknesses and issues.

To learn more about DNA from the given link

brainly.com/question/16099437

#SPJ4

You might be interested in
How is the process in which the ice melts?
Tatiana [17]

Explanation:

it is an endothermic process

Hope I helped

3 0
3 years ago
Electrophysiological studies of rats learning T-mazes have found _________.a. different patterns of activation in the basal gang
Solnce55 [7]

Electrophysiological studies of rats learning T-mazes have found a. different patterns of activation in the basal ganglia during early learning and later stable performance

Explanation:

  • Forced alternation and left-right discrimination tasks using the T-maze have been widely used to assess working and reference memory, respectively, in rodents.
  • Basal ganglia are strongly interconnected with the cerebral cortex, thalamus, and brainstem, as well as several other brain areas. The basal ganglia are associated with a variety of functions, including control of voluntary motor movements, procedural learning, habit learning, eye movements, cognition, and emotion.
  • The direct pathway, sometimes known as the direct pathway of movement, is a neural pathway within the central nervous system (CNS) through the basal ganglia which facilitates the initiation and execution of voluntary movement.
  • Damage to the basal ganglia cells may cause problems controlling speech, movement, and posture. This combination of symptoms is called parkinsonism. A person with basal ganglia dysfunction may have difficulty starting, stopping, or sustaining movement.

3 0
3 years ago
The nurse is caring for a client who has terminal lung cancer and is unconscious. what assessment would indicate to the nurse th
Mila [183]
<span>Mottling of the lower limbs</span>
5 0
4 years ago
What is the national language of the united state
ale4655 [162]
English is the national language of the United States.
6 0
3 years ago
Read 2 more answers
Explain how a chemosynthetic organism would help scientists understand how life
Varvara68 [4.7K]

Answer:how can chemosynthetic organisms help scientists to understand how life developed on earth? for example, temperature, a species may evolve to a temperature change over time. it could alter the food sources available, and then that species would eat that food source and adapt to the energy given off by that source.

Explanation:

3 0
3 years ago
Other questions:
  • A depression in the ground due to a cave collapse or acidic water dissolution of limestone is called a
    15·1 answer
  • "presidential republicanism" is a term used to describe when voters
    14·1 answer
  • What has to happen in order for an ecosystem to be sustained
    6·1 answer
  • Minerals are formed from inorganic materials
    5·1 answer
  • Why are fungal insecticides an attractive alternative to chemical pesticides for growing food crops?
    5·1 answer
  • The diagram below shows the layers of a rock having an ammonite:
    14·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which type of genetic test involves identifying recessive disease-causing alleles in potential parents?
    14·1 answer
  • What is the function of the hormone progesterone? preparation of the body for maintaining pregnancy development of male secondar
    12·2 answers
  • What is the difference between a theory and a law?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!