1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elden [556K]
2 years ago
6

Check Your Understanding 1. A system consists of components of matter and energy and the processes that involve the matter and e

nergy. Sort the items in the list as components of matter, energy, or processes in a system. a. chemical reaction. b. gas c. heat d. lava e. light f. melting g. motion h. rock i. water ​
Biology
1 answer:
irina [24]2 years ago
8 0

Here, matter is gas, rock, lava and water, energy is heat, light. While the process in a system is melting and motion.

<h3>What is matter?</h3>

Matter is any material that has a mass and occupies space by having volume in classical physics and general chemistry.

Energy is a physical system's ability to perform work. The uppercase letter E is a common symbol for energy.

The act of determining the best intercommunication of processing units, as well as the best type and design of units in a process system.

In the given scenario,

  • Mater: gas, rock, lava and water.
  • Energy: heat, and light.
  • Process of system: melting and motion.

Thus, this way the given scenario can be classified.

For more details regarding matter, visit:

brainly.com/question/4513444

#SPJ1

You might be interested in
Which pair of terms concerning the osmotic effect of a solution on red blood cells is mismatched?
QveST [7]
Even though there are no choices given in this particular question, the principle of osmosis is very easy to understand. 

When we talk about osmosis, we are referring to the movement of water from a low concentration to a higher concentration. This is different from diffusion, which talks specifically about the movement of <em>solutes</em> in the solution (from a higher concentration to a lower concentration.)

When an RBC is placed inside a <em>hypertonic </em>solution, the water inside the RBC will go out thereby shrinking the RBC.

Inside an <em>isotonic</em> solution, the RBC will remain the same because the concentrations are equal.

Inside a <em>hypotonic</em> solution, the RBC will lyse or explode because water will move from the solution going inside the RBC. 
4 0
4 years ago
Which best describes how sediment forms? A. Loose material is compacted by pressure. B. Chemical changes cause sediment to cemen
Vesnalui [34]
<span>C. Weathering breaks down rock and other material</span>
3 0
3 years ago
Read 2 more answers
Imagine you have a layer of limestone with high porosity but low permeability. What can you do to increase its permeability to a
Alex_Xolod [135]

Answer:

The answer is remove the overburden  so that there will be less pressure trapping the water.

Explanation:

You can remove the overburden  so that there will be less pressure trapping the water.

8 0
3 years ago
A food chain contains oak trees (producer), mice (herbivore), black rat snakes (carnivore), and bald eagles (carnivore). How man
VMariaS [17]

Answer:

It has 4 trophic levels.

Explanation:

The first level would be the producers, followed by the primary consumers, then the secondary consumers, then the tertiary comsumers.

              /    Tertiary consumers          \

           /   Secondary Consumers           \

        /    Primary Consumers                     \

     /           Producers                                   \

 /________________________________\

5 0
4 years ago
Ramona and her family agree that what got Ramona through law school is what got her through obstacles all her life: her belief i
ziro4ka [17]
Personally, I'd pick C. self-efficacy.
Self-efficacy refers to the confidence that a person has when it comes to their own ability and skills. So Ramona has always believed that she can succeed even when things are tough which is something that got her through both college and life in general.
4 0
3 years ago
Read 2 more answers
Other questions:
  • Which structural feature of the cell membrane allows molecules such as oxygen and carbon dioxide to diffuse into and out of the
    10·1 answer
  • Which feature of model 1 best illustrates how biological information is coded in a DNA molecule?
    7·1 answer
  • The ischemic penumbra can maintain metabolic demand with marginal blood flow from collateral circulation for a maximum of _____
    14·1 answer
  • How is the DNA in a prokaryote different from the dna in a eukaryote
    5·2 answers
  • In order for bone to properly function there are some organs within the Sketo system which play and important role and movement
    9·1 answer
  • Juanita and Alfred hypothesize that a seed will sprout faster if it is warmer. They plant three seeds and water them the same am
    12·1 answer
  • The atmospheric concentration of carbon dioxide increased from 278 ppm in 1790 to 383 ppm in 2007. What is the approximate perce
    15·1 answer
  • I posted this once here it is again please help this is very very very very very urgent!!??!!??
    6·1 answer
  • 22 points!
    7·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!