1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SSSSS [86.1K]
1 year ago
11

Mammalian target of rapamycin pathway mutations cause hemimegalencephaly and focal cortical dysplasia

Biology
1 answer:
GuDViN [60]1 year ago
5 0

Yes, it is true that Mammalian target of rapamycin pathway mutations cause hemimegalencephaly and focal cortical dysplasia.

Focal malformations of cortical development, including focal cortical dysplasia (FCD) and hemimegalencephaly (HME), are important causes of intractable childhood epilepsy.

Using targeted and exome sequencing on DNA from resected brain samples and non-brain samples from 53 patients with FCD or HME, we identified pathogenic germline and mosaic mutations in multiple PI3K/AKT pathway genes in 9 patients, and a likely pathogenic variant in 1 additional patient.

Our data confirm the association of DEPDC5 with sporadic FCD but also implicate this gene for the first time in HME. Our findings suggest that modulation of the mammalian target of rapamycin pathway may hold promise for malformation-associated epilepsy.

Learn more about mutations here : brainly.com/question/17031191

#SPJ4

You might be interested in
What is the energy source for almost all life on earth
Katyanochek1 [597]
The Sun is the energy source for almost all life on earth.
3 0
3 years ago
Read 2 more answers
Complete the following analogy "skeletal is to support as immune is to??
amm1812
Protect. The immune system protects the body from diseases and harmful pathogens. The skeletal system keeps you upright and supports you with help from the muscles.
3 0
3 years ago
In the presence of oxygen and depending on the efficiency of the cell, cellular respiration can produce up to __________________
Alex777 [14]
The process of cellular respiration for a particular cell, depending on its efficiency can produce up to B. 38 ATP molecules, most of which come from chemiosmosis and the electron transport chain.
7 0
3 years ago
Some birds are known as honey guides because they may be followed by humans to wild beehives. When the humans take honey from th
zloy xaker [14]

Answer:mutualism

Explanation:

In a mutualistic relation,both organisms involved benefit from the activities of each other. The benefits may be nourishment,shelter, protection etc.

In the above example,the birds are known to guide humans by responding to specific calls made by the human. They guide humans to beehives and then in return gets to feed on left over honey. Both the bird and human benefits by getting nourishment.

Mutualism is unlike parasitism where one of the organism involved benefits and the other organisms Is most likely harmed. It is also not commensalism, where one organism benefits and the other neither benefits nor is harmed

3 0
2 years ago
Please help me with this
Rasek [7]

Answer:

GGCCATAGGTCCCTTTAGCG

Explanation:

I got a 100%

5 0
3 years ago
Other questions:
  • In two or more complete sentences, describe the similarities between tornados and hurricanes.
    5·1 answer
  • If adenine makes up 20 percent of the bases in a sample of double-stranded dna, what percentage of the bases would be cytosine?
    6·2 answers
  • If the length of a helper t-cell is 20 micrometers calculate the approximate size of a HIV virus
    9·1 answer
  • How are molecules organized
    6·1 answer
  • What is in a bacterial cell
    15·2 answers
  • Some transport processes use transport proteins in the plasma membrane, but do not require atp. this type of transport is known
    15·1 answer
  • The nebular hypothesis suggests that our solar system evolved from a huge _____.
    6·1 answer
  • Your body is made up of about 90 % water. Why is this important to maintain your body temperature during the summertime and wint
    6·2 answers
  • 3 5. Aerobic cellular respiration is _-dependent.
    10·1 answer
  • A researcher returns from the Amazon River with 10 individuals of a species of fish and establishes a small breeding colony in h
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!