1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iren [92.7K]
2 years ago
6

Arrange these groups in order from most inclusive (most general) to least inclusive (most specific).

Biology
1 answer:
LUCKY_DIMON [66]2 years ago
8 0

These groups are arranged in order from most inclusive (most general) to least inclusive (most specific) is gnathostomes, osteichthyans, lobe-fins, tetrapods, amphibians.

<h3>What is gnathostomes?</h3>

The jawed vertebrates are called gnathostomata. The phrase comes from the Greek words "jaw" and "mouth." Approximately 60,000 species make up the diversity of the gnathostome, which represents 99% of all vertebrates still alive today.

<h3>What is osteichthyans?</h3>

A broad taxonomic group of fish called osteichthyes, also known as the "bony fish," has skeletons that are predominantly made of bone tissue.

<h3>What is lobe-fins?</h3>

The taxon Sarcopterygii, also known as Crossopterygii, is made up of bony fishes noted for having lobe-finned fishes as its members.

<h3>What is tetrapods?</h3>

Four-legged vertebrates that make up the superclass Tetrapoda are known as tetrapods, which derives from the Ancient Greek (tetra-) "four" and "foot." It consists of synapsids, dinosaurs, and extinct as well as living amphibians, reptiles, and dinosaur-related birds (including mammals).

To learn more about Tetrapods visit:

brainly.com/question/15289594

#SPJ4

You might be interested in
How is the increase in pulse rate while carrying out vigorous activities related to the rate of oxygen intake and release of car
polet [3.4K]
During exercise there is an increase in physical activity and muscle cells respire more than they do when the body is at rest. The heart rate increases during exercise. The rate and depth of breathing increases - this makes sure that more oxygen is absorbed into the blood, and more carbon dioxide is removed from it.
3 0
3 years ago
Suppose you use a microscope to look at a cell from a leaf. Which of the following structures will you see that would NOT be fou
Brilliant_brown [7]

The answer to your question is,

B. Chloroplasts

-Mabel <3

7 0
3 years ago
Read 2 more answers
Describe what will occur the population if it increases in number when food is scarce?
mote1985 [20]

Answer:

more people will die

Explanation:

If you have a big population and little food mor peple will die.

4 0
3 years ago
Read 2 more answers
Your client's campaign is getting a lot of clicks, but the conversion rate is low. which approach could help improve your client
yuradex [85]
The answer would be: <span>Make sure the landing page is closely related to the ad
</span>
To have high conversion rate, the landing page should give an accurate advertising that closely related to it. Increasing the budget will increase the conversion number, but not the rate. Increasing the CPC bid or broaden the list of keyword won't increase the conversion rate either.

5 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Other questions:
  • How do frogs utilize extensor and flexor muscles in order to swim, jump, and do other frog things efficiently; include specific
    10·1 answer
  • based only on their anatomy rank gorillas bears chimpanzees and mice from most recent common ancestor with humans to least recen
    5·1 answer
  • Overflow flooding occurs in different areas that are called_____.
    13·1 answer
  • Arrange the following items in the order in which they receive electrons from glycolysis and TCA oxidations and harness the ener
    14·1 answer
  • What is a substance that cannot be broken down into other substance
    8·2 answers
  • Which two words best describe the Sun? Select one:
    14·2 answers
  • I need help <br> A)16<br> B)9<br> C)3<br> D)6
    10·1 answer
  • At the end of the mitotic cell cycle, a cell divides into two cells. What must happen before the cell divides? A. The number of
    6·1 answer
  • Predict how changing the grass population will affect the other organisms at first. Write + for “Increase” or – “Decrease” next
    14·1 answer
  • 10. What are two examples of "typos" that happen when DNA is being copied?<br>​
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!