AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
The answer would be brown because all the other beetles have some sort of camouflage while the brown beetle sticks out in all of that green. Hope this helps. :)
Answer:
2
Explanation:
plants do have dna in the nucleus
Geiger-Muller tube is instruments requires you test three times the background of the work area.
<u>Explanation</u>:
These detectors are gas filled detectors and hence requires time for responding to the value. This time is taken because during this period it collects the electric charges and features of the electric circuit. It also gets stabilized during this period. This device has thumb rule i.e one must wait or hold for at the least 3 times the time constant before getting the precise and accurate reading. The time constant order is 10 seconds for the ionization chamber but for the Geiger counter it can vary from seconds to greater than 20 seconds
