1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
DochEvi [55]
1 year ago
12

How to graph this concentration vs Rate of Reaction

Biology
1 answer:
SOVA2 [1]1 year ago
3 0

Plotting a graph of the mass or volume of the product created against time allows you to determine the reaction's pace. This is depicted for two reactions on the graph. The rate of reaction is inversely proportional to the gradient of the line; that is, the steeper the line, the higher the rate of reaction

<h3>What is Rate of reaction ?</h3>

The result is a straight line with a positive gradient on a graph of reaction rate against concentration (a graph showing proportionality).

  • The half-life is constant in a concentration-time graph of first order. As a result, the period of time it takes for the concentration to decrease to 50% of its initial value is constant.

  • It would be considered first order if you obtained a straight line with a negative slope. If you graph the inverse of the concentration for second order

Learn more about Rate of reaction here:

brainly.com/question/24795637

#SPJ9

You might be interested in
transcribe this strand of DNA 5' 3’ TACGCGCATTTCGCCATGAAGACATTTATTCTGCTTCTC into mRNA- and Amino acid-
tino4ka555 [31]

Answer:

AUGCGCGUAAAGCGGUACUUCUGUAAAUAAGACGAAGAG

Explanation:

this is the complementary strand for the mRNA.

A=U

C=G

G=C

T=A

this is the key for any mRNA strand.

;)

3 0
3 years ago
Which of these is not an animal-like protist?
LiRa [457]
The answer would be B mold is not an animal

6 0
3 years ago
Read 2 more answers
Which group of organisms forms the base of the energy pyramid in a pelagic marine ecosystem?
katovenus [111]
Phytoplankton form the base of a pelagic marine ecosystem.
7 0
3 years ago
Read 2 more answers
Describe the role of chloroplasts and chlorophyll
WINSTONCH [101]

Answer:

Chlorophyll is the part of chloroplast and is the light absorbing pigments which provide green color to the plants, but chloroplast traps the solar energy, which is the site of photosynthesis and other chemical reactions and works as the 'powerhouse of the cell' like mitochondria.

8 0
3 years ago
What ultimately happens to the light energy captured during photosynthesis?
rjkz [21]
It is used to produce glucose molecules

6 0
3 years ago
Read 2 more answers
Other questions:
  • The main two characteristics that describe any igneous rock are
    5·1 answer
  • 6. What does SNP stand
    10·1 answer
  • Addison's disease is due to a insufficient output of glucocorticoids only. addison's disease is due to a insufficient output of
    6·1 answer
  • What is true of a gas?
    8·1 answer
  • In January, a small number of Eastern Cottontail Rabbits were introduced into Red Forest. The population curve of the rabbits is
    10·2 answers
  • Explain why decomposers are an important part of a food chain.
    12·2 answers
  • Why do Mercury and Venus not have moons? Choose the statement that best answers the question. Select one: a. There was not an im
    13·1 answer
  • Hi, I need help with this I don't really understand :[
    5·1 answer
  • Most dividing human cells take___________to complete a cell cycle.
    13·2 answers
  • Which statement describing chemical and nuclear reactions are true
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!