1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vlada [557]
4 years ago
8

Make a prediction about how relationships between land and water can influence pollution and the conservation of resources.

Biology
1 answer:
andrey2020 [161]4 years ago
5 0

I think we all can agree, water and land are badly polluted. To stop pollution, more community service, more trash cans and recycling bins, and more laws. As water and land collide (think about the beach) more pollution from the waster is washing up to shore, trash including, soda cans, water bottles, paper, silicone, and even beached animals. Not only does water pollute the land but the land pollutes the water. Including, beach toys, towels, drinks, cellphones, and many more...

You might be interested in
Which organisms develop gills from pharyngeal arches and later develop lungs to breathe on land?
Evgesh-ka [11]
Apart from cutaneous respiration<span> present in all species, most </span>lissamphibians<span> are born in an aquatic </span>larval<span> stage with gills. After metamorphosis they develop lungs to breathe on land. The </span>larvae<span> of </span>urodeles<span> and apods present external, </span>filamentous<span> and highly branched gills which allow them to breathe underwater. Hope this Helps! :)</span>
4 0
4 years ago
Read 2 more answers
Why do all normal cells in human body have same number of chromosomes?
Rainbow [258]
<span>Females have two X chromosomes in their cells, while males have one X and one Y chromosome. Mitosis; before it divides it replicates & meiosis; sex cells have half the amount of chromosomes that a normal cell has so when they join another, there are 46 chromosomes in the cell.</span>
5 0
4 years ago
Read 2 more answers
Each round of the citric acid cycle begins when the four-carbon molecule oxaloacetate is converted to the six-carbon molecule ci
Verdich [7]

Answer:

The added carbon is supplied by acetyl CoA and the 2 eliminated carbons are released as CO2.

Explanation:

TCA cycle or citric acid cycle occurs in the mitocondrial matrix.

           The ist step of TCA cycle deals with the formation of citrate molecule bt the addition of Acetyl CoA with oxaloacetate. The acetyl CoA is a 2 carbon compound formed from pyruvate by the catalytic activity of pyruvate dehydrogenase .

          The 2 eliminated carbons are released as carbon di oxide or CO2.The CO2 molecule is eliminated during the formation of alpha ketoglutarate from isocitrate .The second CO2 molecule is eliminated when alpha ketoglutarate is converted to succinyl CoA.

5 0
4 years ago
The r groups on amino acids determine their unique characteristics. how does an amino r-group on an amino acid behave at ph 7 in
Leviafan [203]

It serves as a base and gains a proton, which charges it positively.

What is amino acid?

Proteins are made up of substances called amino acids. Proteins and amino acids are the components of life. Amino acids are the byproducts of the digestion or breakdown of proteins. Amino acids are used by the body to create proteins that aid in the digestion of meals.

Organic substances known as amino acids have both an amino and a carboxyl group. They can be differentiated by the functional group R that is attached. Six of the twenty amino acids that make up proteins have R-groups that are either bases or acids.

To learn more about amino acids click on the link below:

brainly.com/question/21327676

#SPJ4

6 0
1 year ago
The chemical breakdown of rocks by the action of other rocks and sand particles is called
omeli [17]

The gradual wearing awa or breaking down of rocks by abrasion is a type of? This process causes rocks to change composition when reacting with oxgen? The mechanical breakdown of rocks by the action of other rocks and sand particles is called? ... water located within the rocks below Earth's surface.

3 0
4 years ago
Read 2 more answers
Other questions:
  • Which forest carbon cycle process moves carbon from a Geosphere reservoir to another Geosphere reservoir?
    13·1 answer
  • Who developed the first microscope?
    5·2 answers
  • Judging and evaluaing advertisement requires confusing. thinking. because​
    5·1 answer
  • Protein sources include seafood, eggs, nuts, soy products, and lean meats and poultry.
    13·2 answers
  • Write a general statement, one that applies to all biomes, about the type of organisms found within a biome.
    10·1 answer
  • Porque la tasa fotosintetica del maiz aumenta cuando la intensidad de la luz es mayor?
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • PLEASE I NEED THIS I WILL MARK BRAINLIEST AND GIVE YOU 50 POINTS
    7·2 answers
  • Which important macromolecule plays a role in speeding up processes that 1 point
    13·1 answer
  • Substance A is added to water. After it is added, hydrogen ions are produced and accumulate in the solution. Most of the hydroge
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!