1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
1 year ago
11

What are the two major methods by which cells communicate to coordinate their functions?.

Biology
1 answer:
Anni [7]1 year ago
7 0

Chemical messengers and the Electrical signals are the two main methods by which cells communicate with each other to coordinate their functions and metabolic activities.

According to biologist, A cell communicates through chemical messengers, by sending the chemical signals to other cells and also receive that signal from another cell. Similarly, Electrical signals or impulses also work in the same way.

Therefore, body contains many types of lipids which works as a chemical messengers also electical signal or impulses can easily travel throught these lipids. Cell uses these chemical messengers and electrical impulses to communicate with other cell. Although, In order to trigger a response, these signals are transmitted across the cell membrane of the cell.

Learn more about cell communication here

brainly.com/question/18223077

#SPJ4

You might be interested in
How dose food chain start
monitta

Answer:

The food chain starts with the sun

Explanation: because it provides energy for everything on the planet

4 0
3 years ago
Read 2 more answers
Which of the following population rates is most affected by the species' gestational period?
Tomtit [17]

The correct answer is Birth.

The two elements that raise population size are natality—the number of people who are added to a population over time as a result of reproduction—and immigration—the movement of people into a location. Most births are to folks who are young adults or older. Even at replacement fertility levels (when each woman has approximately an average of two children), there will be more births than deaths if the proportion of young adults to older adults is higher where mortality is highest. Immigration and birth rates lead to population growth. The population shrinks as a result of death rates and emigration. A population that has a negative growth rate is one in which there are more deaths and emigrants than births.

Learn more about natality here:-

brainly.com/question/21290161

#SPJ1

5 0
1 year ago
Read 2 more answers
Fireworks exploding in the sky and giving off light are an example of a(n) _____.
crimeas [40]
Exothermic change. Because the firework when it exploded, released energy in the form of light. In exothermic changes energy is released, and in endothermic changes energy is absorbed.
7 0
3 years ago
Which is an example of an inherited trait?
Serga [27]
The answer would be D being those are all learned or earned attributes.
3 0
4 years ago
Read 2 more answers
Explain how strong acids differ from strong bases in reference to H+ and OH+ ions stating whether there is a lot or a little in
Ierofanga [76]

Answer and explanation;

-Strong acids and bases are defined as compounds that completely ionize in water or aqueous solution. Weak acids and bases only partially dissociate.

A strong acid will fully dissociate in water to form H+ ions.

HCl + H2O---> H3O+ + Cl-  

This reaction is non-reversible. After dissolution, only a very very minute concentration of HCl itself remains in the solution, as most of the diluted HCl  has dissolved into ions.


Ka = [H+] [Cl-] / [HCl]

The same applied for bases. The only difference is that the base dissociates to form OH- ions instead.

Strong and weak bases will depend likewise on whether the reaction is reversible.

A strong base will completely dissociate to give more OH- ions.

An example of a strong base;

NaOH + H2O ---> Na+ + OH- + H2O


Kb = [Na+] [OH-] / [NaOH]

4 0
3 years ago
Other questions:
  • Like DNA, RNA contains<br> a. phosphate.<br> b. uracil.<br> c. thymine.<br> d. deoxyribose.
    9·1 answer
  • Assume that blending inheritance, not particulate Mendelian inheritance is operating in a life form. An individual with a tail t
    13·1 answer
  • When reviewing the history of a patient who will be taking an antifungal drug?
    15·1 answer
  • Which statement correctly describes an interaction of the respiratory and
    7·1 answer
  • Gravity is the force by which a planet or other body draws objects toward its center. The force of gravity keeps all of the plan
    7·1 answer
  • True or false: Mechanical weathering changes the size and shape of rocks.
    9·2 answers
  • What chemicals are the sides of the DNA ladder made of?
    5·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • If you want to know the genotype of a pea
    7·2 answers
  • The Sting of bees contains which acid ​
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!