1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
katovenus [111]
1 year ago
11

Sedimentary Rock Questions. Will give brainliest

Biology
1 answer:
solong [7]1 year ago
7 0

The way that compaction lead to lithification is that due to the heavy pressing force of the deposits above, compaction causes the sediments to become more tightly packed. The original pore space that separated the sediment grains is shrunk as sediment is compacted.

2. The way that cementation lead to lithification is that: Sediment lithification can also happen as a result of cementation. The process through which dissolved minerals crystallize and bind sediment grains together is known as cementation.

<h3>3. How do chemical sedimentary rocks form?</h3>

Chemical sedimentary rocks can be found in a variety of environments, including caverns, deserts, and the ocean. Chemical precipitation, which starts when water moving through rock dissolves part of the minerals, creates chemical sedimentary rocks. When the water evaporates, the minerals are finally redeposited or precipitated after being moved away from their source.

<h3>4. The three main types of sedimentary rocks?</h3>

There are three key groups of sedimentary rock are: clastic rocks, organic rocks, and chemical rocks.

  • Calyx rocks: When rock pieces are compressed together under high pressure, sedimentary rocks are created.
  • When layers of plant and animal remnants are deposited, organic rocks are created.
  • Chemical rocks: When minerals crystallize from a solution, sedimentary rocks are created.

<h3>5. How can different types of limestone be bioclastic, chemical, and organic?</h3>

The majority of the time, limestone is a type of biological sedimentary rock that develops as an accumulation of shell, coral, algal, fecal, and other organic waste. The precipitation of calcium carbonate from lake or ocean water is one example of a chemical sedimentary process that might cause its formation.

An organism's body can form a sedimentary rock. Lithification transforms plant material into coal. Limestone is created when shells are bonded together. Therefore, limestone might be categorized as organic or chemical.

<h3>6. The sedimentary rock types by grain size, from small to large.</h3>

They are:

  • Breccia: Large and Angular.
  • Sandstone: Sand-sized .
  • Siltstone: Silt-sized, and smaller than sand .
  • Shale:  Clay-sized and the  smallest .

Learn more about sedimentary rock  from

brainly.com/question/2599180
#SPJ1

You might be interested in
Suppose in a hospital in the United Kingdom, out of 100,986 of babies born in the last 20 years, 15 children were born with myot
mixer [17]

Answer:

20 percent

Explanation:

Dystrophia myotonica protein kinase gene, DMPK is a kind of autosomal dominant mutation. Since this disease is autosomal, it is not affected by the sex chromosome. Out of total 23 chromosome pairs in human being, 22 are autosomal chromosome while one pair is sex chromosome. Also autosomal dominant means that the mutated gene is a dominant gene that is found in the non sex chromosomes.

Thus, only one mutated allele is required to pass on the mutation through the families hierarchy.

Thus, the mutation rate of the DMPK gene is

\frac{3}{15} * 100\\= \frac{1}{5} * 100\\= 20%

7 0
4 years ago
Read 2 more answers
5’ATGCCCGGGTGTCGTAGTTGA3’<br><br> Complete the complementary sequence for the template strand.
dusya [7]

Answer for this question will be

3' TACGGGCCCACAGACTCAACT5', If the given strand is for RNA transcription than the complementary strand  will be 5'UACGGGCCCACAGCAUAACU 3'

8 0
3 years ago
Which best describes the lower body structures of humans and chimpanzees?.
Tomtit [17]

Answer:Which best describes the lower body structures of humans and chimpanzees? The big toes of humans and chimpanzees are enlarged. The human foot has two arches, but the chimpanzee foot only has one.

Explanation:please give brainliest

6 0
3 years ago
Why is fire considered a density-independent limiting factor?
Sever21 [200]

Answer:

DENSITY-INDEPENDENT FACTOR

Density-independent factor

biology

BY The Editors of Encyclopaedia Britannica View Edit History

FULL ARTICLE

Density-independent factor, also called limiting factor, in ecology, any force that affects the size of a population of living things regardless of the density of the population (the number of individuals per unit area). Density-independent factors often arise from physical and chemical (rather than biological) phenomena.

forest fire

forest fire

See all media

Related Topics: Population

Such factors stemming from weather and climate—as well as flooding, wildfires, landslides, and other disasters—affect a population of living things whether individuals are clustered close together or spaced far apart. For example, for most organisms that breathe oxygen, oxygen availability is a density-independent factor; if oxygen concentrations decline or breathable oxygen is suddenly made unavailable, such as when oxygen-using plants are covered by rising floodwaters, those organisms perish and populations of the various affected plant species decline.

The dynamics of most populations of living things are influenced by a combination of density-independent factors and density-dependent factors (that is, those factors that emerge when the concentrations of individuals in a population rise above a certain level). The relative importance of these factors varies among species and populations.

3 0
3 years ago
Read 2 more answers
Explain how microbiology can play a role in bread industry​
Andrei [34K]

Answer:

Food microbiologists research micro-organisms in food and are tasked primarily with preventing food-borne diseases. They study food poisoning, spoilage, and preservation, as well as participating in food

3 0
3 years ago
Read 2 more answers
Other questions:
  • Complete the following statement. Our solar system is part of the _________ galaxy.
    9·2 answers
  • Oxygen has 17 known isotopes. The atomic number of oxygen -16 is 8. What can you tell me with this information about isotopes of
    9·1 answer
  • Should a monocercomonoide be considered a life-form?
    6·1 answer
  • What role do the mountains play in creating biome?
    6·1 answer
  • What is the type of chemical reaction used to rebuild ADP into ATP?
    10·1 answer
  • The body uses carbohydrates for _____ - term energy storage.
    13·1 answer
  • Louis pasteur tambien propuso que los microorganismos son la causa de algunas enfermedades escribi que problema pudo haber lleva
    9·1 answer
  • Which question cannot be tested with Scientific investigation?
    6·1 answer
  • Honey bee is a social insect .Why?
    5·1 answer
  • What science and biology have in common<br> and why
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!