1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
3 years ago
6

If water vapor continue to increase in our atmosphere of what changes would you expect in freshwater lakes

Biology
2 answers:
Jobisdone [24]3 years ago
7 0
Lake temperatures will increase but dissolved oxygen in the water will decrease. Water vapour is a potent greenhouse gas, so global temperatures will increase, including lake temperature. Additionally, increased water vapour in the air will decrease the amount that can evaporate from the lake and further reduce the amount that it can cool, in which makes the water warmer still. Water temperature increases mean decreased the solubility of gases (above 4 degrees C), so dissolved oxygen would cease to decrease on a ppm basis. I hope this answer has helped you. 
stira [4]3 years ago
3 0

Lake temperatures will increase, but dissolved oxygen in the water will decrease.//took this quiz it's the answer

You might be interested in
____ worms cause the most economic damage...?
Elza [17]
Earth worms cause the most ecconomic damage
6 0
3 years ago
Read 2 more answers
(GIVING BRAINLIEST!!)
ra1l [238]

Answer:

I'm not sure, but I think it's B

Explanation:

Condensation's is the conversion of a vapor or gas to a liquid, so I think it's B

6 0
3 years ago
Read 2 more answers
Water and the Earth 1:Question 3
Alenkasestr [34]

Answer:

Runoff

Explanation:

The other answers involve the water particles rising to the clouds. So those processes work against gravity and not with it. Runoff uses gravity to flow back into the ocean or large body’s of water.

4 0
3 years ago
Molecule 1 has the nitrogenous base sequence TCAAGT. Which set of bases in molecule 2 can bond to that sequence in a complementa
lidiya [134]

The right answer is AGUUCA.

Molecule 1 represents DNA and molecule 2 represents mRNA.

An mRNA molecule is made (thanks to RNA polymerase) according to the complementary code (with the exception that U replaces the T) of the transcribed DNA strand (template or antisense strand).

A is in front of the U

T is in front of the A

G is opposite of C (or vice versa)

5 0
4 years ago
The tRNA for GUCAUCGAUCGAUCGGAUGCC
Lapatulllka [165]

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

3 0
3 years ago
Other questions:
  • 11.   Which of the following accurately describes a step within transcription?      A. The RNA strand forms a template by which
    13·1 answer
  • Which of the following statements are true regarding the process of photosynthesis
    8·1 answer
  • An example of a dependent variable in an experiment might be _____. eye color level of depression gender blood type
    8·1 answer
  • Why are ions and polar molecules unable to pass easily though the lipid bilayer?
    7·1 answer
  • Collagena. is a protein.
    5·1 answer
  • *Hedgehogs are nocturnal and hibernate during the winter. Which of the
    6·1 answer
  • A divergent boundary occurs where two plates a. move toward each other. c. move past each other. b. move away from each other. d
    5·1 answer
  • In mitosis, each chromosome is made up of __________ that carry the same alleles.
    11·2 answers
  • Which conditions are necessary for natural selection to occur? Select all of the answers that apply.
    5·2 answers
  • -<br>-<br>What molecule or gas is not necessary for plants and is then released?​
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!