Answer:
A census is a count of the population in particular areas.
Explanation:
Answer:
Mountains are cooler than plains because with increase in height the temperature decreases. EXPLANATION: Mountains are located in high elevations and plains are located in low elevations. Their respective heights are measured by term called as their height above sea level.
<span><span>Polar Easterlies
</span><span>Prevailing Westerlies (aka Westerlies).
</span><span>
Tropical Easterlies (aka Trade Winds).
</span></span>
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The study of relationships and the evolutionary history of various groupings of species is known as phylogeny. The goal of phylogeny is to reconstruct the evolutionary course of all species on Earth. A phylogenetic tree also learned as a cladogram, is a schematic diagram used to show the alleged evolutionary relationships between taxa. Diagrams of phylogenetic trees are based on cladistics, or phylogenetic systematics, hypotheses.
Organization of life, according to taxonomy, divides creatures into three domains:
The Eukarya domain are the most easy because they are large enough for their morphological features to be easily seen.
To learn more about phylogenetic click here
brainly.com/question/13577065
#SPJ4
