1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
PolarNik [594]
3 years ago
9

What produces two ATP molocuels

Biology
1 answer:
Snowcat [4.5K]3 years ago
6 0
Don't quote me, but cellular respiration creates ATP.
You might be interested in
According to the information on the periodic table, which of the following could represent element X?
gogolik [260]

chlorine because it has 7 electrons on the outer shell

8 0
2 years ago
Which of the following polymers is found in cell membranes?
inysia [295]
Lipids are found in cell membranes in double layer which is called "Lipid-bilayer".

So, option A is your answer.

Hope this helps!
7 0
4 years ago
Specialized cells are grouped into structures known as
gregori [183]
Your answer should be tissues.
5 0
3 years ago
NacL is dissolved in water so that the concentration is initially higher in one part of the water the other,______ will occur so
mixas84 [53]
NaCl is dissolved in water so that in a given region or volume the concentration is initially higher in one part than the other l, thus simple diffusion will occur so that there is a net difference or 0, with respect to the concentration of NaCl in a particular volume of water than another. Basically the NaCl will be distributed throughout volume of water.
6 0
3 years ago
Darwin’s theory of common descent states that all organisms _____.
choli [55]
The correct answer would be the last one: "evolved from past organisms." This theory basically just states that all living organisms evolved from a single common ancestor. Hope this helped! :)
6 0
3 years ago
Read 2 more answers
Other questions:
  • What is syntax?
    6·2 answers
  • How much ampicillin would be needed to prepare 10 ml of 100 mg/ml solution?
    7·1 answer
  • Which city on the great plains has fewer air pollutions due to the weather?
    12·1 answer
  • Which statement correctly describes the mechanism of inheritance?
    12·2 answers
  • Which of the following is an environmental consequence of importing resources into the United States?
    15·2 answers
  • Complete the sentence. Water carries minerals called ____ that are critical to many functions in the body.
    5·2 answers
  • HURRY 30 POINTS) Look at the following diagram.
    15·1 answer
  • Describe the relationship between the respiratory and circulatory systems and ATP. Use the term reactants in your response.
    8·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • Exposed to the same conditions as the experimental group, except for one independent variable.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!