1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fudgin [204]
4 years ago
12

The Dutch use most of the land reclaimed from the sea for

Geography
1 answer:
alexandr402 [8]4 years ago
7 0
For growing crops :) !
You might be interested in
You may turn right on a solid red light:
Vaselesa [24]
The answer is:  [B]:
________________________________________________________
     "<span>Only after stopping, and yielding to pedestrians, and bicyclists, unless otherwise posted."
___________________________________________________________</span>
6 0
3 years ago
A(n) is a bend in a steep narrow bedrock valley. 2. The lowest level to which a stream can erode is called . 3. A(n) is the remn
borishaifa [10]

Answer:

1. Incised meander.

2. Base level.

3. Terrace.

4. Lake

5. Meander.

6. Floodplain.

Explanation:

Erosion can be defined as a geological process which typically involves the wearing out of earthen (soil) materials and the transportation of these materials by natural forces like water, wind, etc. Soil erosion is greatest when the soil is steep.

The steepness of a body such as river or stream refers to the downward slope or gradient of the body of water.

Generally, the steepness of a body affects the rate at which other materials would flow or move around. Thus, the steeper a river or stream, the greater would be its rate of erosion.

Some of the characteristics of an erosion include the following;

1. An incised meander is a bend in a steep narrow bedrock valley. It avails a river large amount of vertical erosion power and as such enabling a downcut.

2. The lowest level to which a stream can erode is called a base level. Some examples are dam, waterfall, lake, stream, etc.

3. A terrace is the remnant of a former floodplain.

4. Examples of local base level include a stream or a lake.

5. A sweeping bend of a stream which is migrating laterally in a wide, flat valley is called a meander.

6. The flat, broad area surrounding a stream is referred to as a floodplain.

3 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What is unique about the emerald edge?
elixir [45]

Answer:

The Emerald Edge is the largest intact coastal rainforest remaining in the world.

Explanation:

i am smart

7 0
3 years ago
Along which coastline do bathers enjoy a warm ocean current?
Delicious77 [7]

Answer:

<u>1. c. Peruvian coast, 2. c. Asia, 3. c. Paris, 4. Andes</u>

Explanation:

  • Peru is located on the western coast of South America and faces the pacific ocean and located in the southern hemisphere it shares the longest border with brazil. Having a total area of 1,285,215.6 km square.
  • Due to the latitude, mountain ranges and topography variations and the two oceanic currents like the Humboldt and El Niño which bring a diverse tropical climate of wt and dry spells to this region thus experiences a drought type conditions of the coasts of Peru.
  • Places on earth most likely to encounter the trade winds are in Asia as these winds are moving in an east to west direction following the earth equatorial region, i.e 30 degrees North and South.
  • To get the shortest flight from Los Angles to Moscow the plane would have to land in Paris as to refuel and thus making it the shortest flight by less than half-hour.
  • Andes mountain runs parallel through the south American north to south borders.
3 0
3 years ago
Other questions:
  • What were two of France's economic goals after World War II?
    15·2 answers
  • Is haiti located in south america?
    9·1 answer
  • What is produced by converging trade winds?
    11·2 answers
  • List the 6 layers deposited and or eroded
    7·1 answer
  • If the same organisms appears on two different continents, this is evidence of
    14·2 answers
  • PLZ HELP ME I BEG YOU!!!<br> land use energy resources natural resources in japan?
    12·1 answer
  • Please help me I need help
    15·1 answer
  • Ang Tao ay
    6·1 answer
  • Suggest why the impacts of an earthquake may be more severe in a LIC than a HIC
    9·1 answer
  • Explain Earth's role as a body in space
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!