1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Studentka2010 [4]
3 years ago
11

NacL is dissolved in water so that the concentration is initially higher in one part of the water the other,______ will occur so

that there is a net
Biology
1 answer:
mixas84 [53]3 years ago
6 0
NaCl is dissolved in water so that in a given region or volume the concentration is initially higher in one part than the other l, thus simple diffusion will occur so that there is a net difference or 0, with respect to the concentration of NaCl in a particular volume of water than another. Basically the NaCl will be distributed throughout volume of water.
You might be interested in
Renin, released from the kidney as a result of a decrease in blood pressure, acts on ________ produced in the liver. This trigge
blsea [12.9K]
Your just bad at life
6 0
3 years ago
How many new volumes would each new cell contain whenever a cell splits?
Elenna [48]
The specific volume will be different for various kinds of cells. The safe answer would be that the new cell will pretty much have the same volume as the one that it divided from. This is true for most eukaryotic cells unless other factors like epigenetics or mutations come into place.

One example of moments a cell would increase in volume is during hypertrophy. This simply means that the cell is increasing in size (compared to: hyperplasia -- which is an increase in number of the cells). Hypertrophy is definitely an increase in volume of the cell but this doesn't necessarily translate to cell division (i.e. just because the cell is big now, doesn't mean it will still be big when it divides).

Another moment of increasing volume of the cell and now also related to cell division would be during the two stages in the cell cycle (i.e., G1 and G2 phases). This is the growth phase of the cell preparing to divide. However when mitosis or division happens, the cells will normally end with the same volume as when it started.

This are safe generalizations referring to the human cells. It would help if a more specific kind of cell was given.
4 0
3 years ago
Read 2 more answers
Which phase of drug development is associated with continual evaluation of the drug?
AnnyKZ [126]
<span>There are three phases of clnic study and one post approval phase required by the Food and Drug Administration (FDA) for a New Drug Application (NDA). Phase IV which is a common stipulation by the FDA includes continual evaluation of the drug after approval has been granted.</span><span />
7 0
3 years ago
Which of the following characteristics do most amphibians share?
insens350 [35]

Answer:

`B

Explanation:

4 0
3 years ago
Read 2 more answers
Every time you eat a cookie or candy bar, your blood sugar increases. this triggers an increase in the hormone _____.
wel
Every time you eat a cookie or candy bar, your blood sugar increases. This triggers an increase in the hormone insulin.   Insulin<span> is a hormone made by the pancreas which allows your body to use sugar (glucose) from carbohydrates in the food that you eat, or to store glucose for future use. </span>Insulin<span> helps keeps your blood sugar level from getting too high (hyperglycemia) or too low (hypoglycemia).</span>
5 0
3 years ago
Other questions:
  • A spontaneously aborted human embryo is characterized with respect to karyotype, and it is found to be normal except that it con
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Red-green color blindness is an x-linked recessive condition in humans. a man with normal vision had 8 children with a women tha
    5·1 answer
  • Which of the following is a characteristic that could be applied to both living and nonliving things
    14·1 answer
  • A doctor examines the solid waste of a patient. Which would most likely be evidence that the person is not digesting food correc
    6·2 answers
  • What is another name for colonizing lands?​
    12·1 answer
  • An ecosystem has experienced a recent decrease in its plant populations. Which of the following is a possible reason for the dec
    13·2 answers
  • The pedigree chart below shows the Jones family. The mother is purebred dominant for the widow's peak trait. The father is pureb
    10·2 answers
  • EXPERT HELP EXPLAIN THE ANSWER:
    11·2 answers
  • PLEASE HELP ME!!!!! I NEED HELP!!
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!