1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lara31 [8.8K]
3 years ago
7

Do y’all know this if so I can u please help

Geography
1 answer:
Rina8888 [55]3 years ago
3 0

Answer:

I can BARELYY see the question, pls take a better pic and then I'll edit my answer to help yu

Explanation:

You might be interested in
How many major river systems does mississippi have?
mario62 [17]
Six:
1. Upper Mississippi
2. Arkanas River
3. Illinois River
4. Missouri River
5. Ohio River.
6. Red River
7 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
What is located at equal distance from the North Pole and south pole
Vlad [161]
The PERIMETER of the equator cycle is about 40,000Km. The Greenwich cycle is a bit shorter as the earth is a bit an ellipsoid. About 37,000Km by Google Maps. The distance on the envelope between ANY antipodes (=opposite points on the axis, I won't use "diameter" to avoid confusion) is HALF the perimeter (If you walk the whole perimeter long, you'd get to the same point, of course). The distance through Earth is

D=P/Pi=37,000Km/Pi=about11777Km
7 0
3 years ago
Read 2 more answers
Which climate would be the best for farming a variety of crops year-round?
Ludmilka [50]

Answer:

The Mediterranean climate zone.

Explanation:

(because this zone has mid to warm climate with seasonal rainfall in the winter months helps in the cultivation of grain crops like wheat and barley. Fruits like grapes, figs, walnuts and olives grow well in Mediterranean climate due to ideal soil types and dry summers.)

8 0
3 years ago
Which of the following is a Germanic langauge?
Alenkasestr [34]
Correct answer is A, English.  Since it's asking for a Germanic language, which is a branch of Indo-European languages that consists of German, English, and Scandinavian languages.
5 0
3 years ago
Other questions:
  • Identify three advancements in technology that emerged during the Second Agricultural Revolution and changed agricultural practi
    7·2 answers
  • The ideology that supports unity and cooperation among all African nations is known as __________.
    14·2 answers
  • What information does a world climate map show
    14·2 answers
  • The photograph below shows a Foucault pendulum at a museum. The pendulum knocks over pins in a regular pattern as it swings back
    9·2 answers
  • Which statement describes the relationship between history and geography?
    14·1 answer
  • As evidence supporting the Big Bang theory, what does the redshift of light from galaxies indicate? (1 point)
    15·1 answer
  • Landslide - Vajont Dam Slide, Italy. These placemarks fly you to the site of the Vajont Dam disaster that occurred in Italy in 1
    6·1 answer
  • Identify the First Nation to become independent from colonial rule
    7·2 answers
  • What type of values does NATO promote?
    9·2 answers
  • Please give answer i will give brainliest​
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!