1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lukranit [14]
3 years ago
9

Please!! I really need help with this! Its due tomorrow!! Answer this question please!!!!!!

Biology
1 answer:
balu736 [363]3 years ago
7 0

Cellular Respiration is the making of energy in the mitochondria. Photosynthesis is the production of oxygen in the chloroplasts. Their reactants are the products of each other.

You might be interested in
The original population of brown spotted deer declined drastically after their forest habitat was flooded. After frantic efforts
Snezhnost [94]
I believe it would be the bottleneck effect. hope that helps =)
6 0
3 years ago
Read 2 more answers
[25 points] what type of organism is the least numerous in a marine ecosystem? (producer, primary consumer, secondary consumer,
Arisa [49]

Answer:

secondary consumer

Explanation:

They are the least because they play a less important role in the ecosystems.

6 0
3 years ago
Contrast How is faciliated diffusion<br> diffrent from active transport
Mazyrski [523]

Answer:

Explanation:

Whereas facilitated diffusion is a passive process and does not require energy. Active transport uses carrier proteins

8 0
3 years ago
During photosynthesis, the energy from sunlight is used to split water molecules. What happens to the hydrogen ions that are spl
dalvyx [7]
They build up in the thylakoid, where they bond to each other to create ATP.

Not 100% about this but that's what i got.
8 0
3 years ago
Assembling a complete sequence from fragment sequences
Soloha48 [4]

Answer:

"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.

Explanation:

The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.

7 0
3 years ago
Other questions:
  • The plasma membrane is composed of a phospholipid bilayer with embedded proteins. What is one of the functions of the embedded p
    9·2 answers
  • Why rhizoids not called roots?
    11·1 answer
  • What mineral particle is the smallest in size? <br> A. Sand<br> B. Clay<br> C. Silt<br> D. Loam
    7·2 answers
  • A recessive gene located on the X chromosome is the cause of hemophilia in affected individuals. Males are more likely to have h
    12·1 answer
  • Explain why plants can grow at the bottom of the pond (2-3 sentences)
    12·1 answer
  • Mr. Burns, a retired neighbor of Roger's, is angry at Roger for playing loud music. Roger, who is 9 years old, notices that it i
    7·1 answer
  • this scientist was important and that she obtained an x-ray photos of DNA which help determine its structure
    12·1 answer
  • If the earthquake's focus was 2 kilometers below Earth's surface, the earthquake occurred in the?
    8·1 answer
  • A forensic scientist is trying to find out the number of adenine bases in the DNA sample that he obtained from a crime scene.
    8·1 answer
  • Using this info how the two different species were formed
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!