I believe it would be the bottleneck effect. hope that helps =)
Answer:
secondary consumer
Explanation:
They are the least because they play a less important role in the ecosystems.
Answer:
Explanation:
Whereas facilitated diffusion is a passive process and does not require energy. Active transport uses carrier proteins
They build up in the thylakoid, where they bond to each other to create ATP.
Not 100% about this but that's what i got.
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.