1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
djyliett [7]
3 years ago
11

When it comes to identifying the process that form rocks, the present is the key to the

Biology
1 answer:
Strike441 [17]3 years ago
8 0

Rocks are identified primarily by the minerals they contain and by their texture. Each type of rock has a distinctive set of minerals. A rock may be made of grains of all one mineral type, such as quartzite. Much more commonly, rocks are made of a mixture of different minerals. Texture is a description of the size, shape, and arrangement of mineral grains. Are the two samples in figure 2 the same rock type? Do they have the same minerals? The same texture?

Explanation:

You might be interested in
?Which word in the sentence is the predicate nominative? A killer whale is a mammal with a black body and white patches. A. mamm
Lera25 [3.4K]
The answer is A, 'a mammal' because it goes with the copulative verb 'to be', i. e., 'is'.
8 0
3 years ago
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
One common test of language lateralization is invasive; it involves injecting ____________ into the carotid artery.
vova2212 [387]

Answer:

barbiturate/sedatives

Explanation:

Lateralization is a process of studying the split functions of the brain hemispheres. The most common test used for testing lateralization is obtained from sodium amytal studies. In this study a barbiturate or a sedative is injected into the carotid artery either left or the right artery. So, till the time the barbiturate hampers the functioning of any hemisphere, the functions associated with that hemisphere also gets hampered or are sustained for a while. This technique is of invasive nature

4 0
3 years ago
Uncontrolled cell growth would most likely be attributed to which of the following
liberstina [14]
Just think about cancer.. it's uncontrolled cell growth, so mutations in genes can cause cancer by accelerating cell division. As the cells contribute to grow they then develop as a tumor.
8 0
2 years ago
Cell specialization in the human body is usually due to ____.
Vanyuwa [196]
I will go with A ....as radiation is out of question..... DNA sequence is same in all.......I don't think evolution is a mistake !

so A
4 0
2 years ago
Read 2 more answers
Other questions:
  • In the illustration, which site is an example of a trench ?
    14·2 answers
  • Cnidarians such as jellyfish have radial symmetry. how are the body parts of cnidarians arranged?
    14·2 answers
  • Which of these animals would most likely be found in a tundra biome
    11·1 answer
  • Fertilizer occurs when_____.
    6·1 answer
  • While brain efficiency can vary from person to person, certain activities seem to correlate with less cognitive decline. Which i
    6·1 answer
  • Fungi can't produce their own energy but instead take in nutrients from their environment. This makes fungi
    15·2 answers
  • Answer this question (30 points),
    5·1 answer
  • Through what protein can water cross the cell membrane
    13·2 answers
  • If you were to look at a mass of cells under the microscope in which part of the cell cycle would you expect to find most of the
    12·2 answers
  • HELP!! This is part of a big project I have and it’s a big part of my grade please help
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!