1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kakasveta [241]
3 years ago
6

What is the surface for chemical activity

Biology
1 answer:
irga5000 [103]3 years ago
7 0
It is a membranous network found in the cytoplasm. The surface for chemical activity in a cell is the endoplasmic reticulum.
You might be interested in
What are two thirds of an amoeba made out of
adelina 88 [10]
Cells because they are living things. Hope this helps! ;D

3 0
3 years ago
Wolves are predators of deer. What is most likely to happen to the deer population if the wolf population increased?
777dan777 [17]

Answer:

It would decrease and become extinct because all of the wolfs would eat the dear.

Explanation:

6 0
4 years ago
Read 2 more answers
As fluid speed increases air pressure increases <br> -true <br> -false
bixtya [17]

Answer:

False

,As fluids speed increases air pressure decreases

Explanation:

See the image for explaination.

3 0
3 years ago
A hawk receives energy by eating other animals. What type of organism is a hawk?
guajiro [1.7K]

I think that's the hawk is a primary comsumer

Hope this helped

8 0
3 years ago
Read 2 more answers
What are the odds of a white flower
Sedaia [141]
A one in one thousand one chance
7 0
2 years ago
Other questions:
  • Ionic bonds show which characteristics that aren't seen in covalent bonds
    12·2 answers
  • Oxygen is attached to _______.
    10·1 answer
  • Would someone Please answer this question please will be thanked and also will pick brainly!! (please be honest)
    12·1 answer
  • What would happen to the body if the digestive system stopped working?
    9·1 answer
  • The venn diagram compares aerobic respiration and anaerobic respiration. which statement could be categorized in the overlapping
    13·1 answer
  • The myelin sheath that covers many CNS axons is formed by
    11·1 answer
  • What characteristic best distinguishes runoff and infiltration
    13·1 answer
  • Please help finish the sentence:
    11·1 answer
  • What color would a normally green leaf be under a light that only emitted red colored light
    6·1 answer
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!