1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darya [45]
3 years ago
9

A measure of the number of particles of a substance in a given volume

Biology
1 answer:
Misha Larkins [42]3 years ago
7 0
A measure of the number of particles of a substance in a given volume would be concentration. <span>In chemistry, </span>concentration<span> is the abundance of a constituent divided by the total volume of a mixture. There are a number of ways expressing it such as molarity, molality, normality, ppm, percentage and the like.</span>
You might be interested in
CORRECT ANSWER GETS BRAINLIST PLS HELP
olganol [36]

Answer:

Your answer is B. Multiple Personality Disorder

7 0
2 years ago
Look at the molecule of ATP below. What would need to change about it for the cell to use the energy stored within the molecule?
kolezko [41]

Answer:

A

Explanation:

The only way for a cell to use energy stored within a molecule is in this example would be to break the bond between 1 and two because it would be impossible for energy to get to 3, 4, 5.

6 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
2 years ago
The weather of a region depends on _____
Veronika [31]

Answer:

The weather of a region depends on amount of sunlight it receives, its height above sea level, the shape of the land, and how close it is to oceans.

Explanation:

5 0
3 years ago
The first law of thermodynamics states that energy can't be created or destroyed. If people can't create energy, where do we get
Sergeu [11.5K]

Correct answer: B). Food and fossil fuels

The energy can not be created nor destroyed but it can be transformed into another form. The ultimate source of energy on this planet is the sun, the sun provides sunlight where sunlight is converted into chemical energy, which is used by plants to prepare food. Then we consume food prepared by plants to get energy and perform various types of work like movement, reproduction, growth etc. In this, the chemical energy is converted into mechanical energy.

5 0
3 years ago
Other questions:
  • Paco garcia calls in a panic. one of his workers cut his arm on a saw, and the wound is bleeding profusely. which artery should
    14·1 answer
  • Ground tissue is found in a plant’s.... A. Stems only B. Stems and leaves only C. Roots and stems only D. Roots, stems, and leav
    13·1 answer
  • Microevolution, or evolution at its smallest scale, occurs when
    13·1 answer
  • Which of the following could be a method used to estimate the age of an ancient rock? To find out its mineral composition To fin
    5·2 answers
  • Christopher consumed food tainted with listeria monocytogenes. when this bacterium enters the digestive tract, it causes illness
    8·2 answers
  • How does human evolution or natural selection relate to the susceptibility of disease?
    14·1 answer
  • Why is it essential that threatened<br> species compete for resources successfully
    9·1 answer
  • A male and a female are both heterozygous for a particular trait. Which of the following represents the expected ratio of domina
    9·1 answer
  • Warm water rises because it is ............ than cool water.
    7·2 answers
  • Who uses the oxygen plants release during photosynthesis?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!