The continental plate is thicker and less dense while the oceanic plate is thinner and more dense.
They acquire energy by consuming other species which is one level less in that corresponding trophic level.....
Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)
Explanation:
The answer is true! Thank you in advance for brainliest
