1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
2 years ago
13

A plane is a flying at an altitude of 23,760 feet. Which expression can be used to find the altitude on miles.

Mathematics
1 answer:
Zina [86]2 years ago
6 0

Answer:

D. 23,760÷5,280 assuming that 5,5,280 is a typo

Step-by-step explanation:

If you divide it will give you the height in miles because there are 5,280 feet in a mile.

You might be interested in
Answer the question as soon as possible
expeople1 [14]

Answer:

  • D. Distributive

Step-by-step explanation:

<u>This is:</u>

  • a(b + c) = ab + ac  - Distributive property

Correct choice is D

6 0
3 years ago
PLEASE HELP! I need step by step!
sergeinik [125]

Answer:

C x +2y=8

Step-by-step explanation:

x+2y=8

x-x +2y = 8 -x

2y=8 -x

2y/2= 8/2 -x/2

y= 4 -1/2x

y= -1/2x =4 is the final answer

so it would be c

7 0
2 years ago
Please help!! I can’t figure this out
Rudiy27
Each room has 2 walls that are 4x10 = 40 square feet and 2 walls that are 8x10 = 80 square feet. So 80+80+40+40 = 240 square feet of wall will be painted per room.

We use 2 coats of paint so in effect, we double the area. Imagine laying one thin wall on top of the other. The amount of paint area used per room doubles from 240 to 480

There are 4 of these rooms so 4*480 = 1920

The total area we need to paint is 1920 square feet

Divide this over 32 to get 1920/32 = 60

Final Answer: 60
5 0
2 years ago
Rewrite 0.1 as a power of 10.
USPshnik [31]

Answer:

10^-3

Step-by-step explanation:

8 0
3 years ago
Prove 2(2x+4)= 16 2(2x) by using the laws of exponents.<br> boris9
storchak [24]

The prove that the equation can be verified using the laws of exponents.

<h3>What is the proof of the equation given; 2^(2x+4)= 16 × 2^(2x)?</h3>

It follows from the task content that the equation given is; 2^(2x+4)= 16 • 2^(2x).

It follows from the laws of indices ; particularly, the product of same base numbers.

The evaluation is therefore as follows;

2^(2x+4)= 16 • 2^(2x)

2^(2x) • 2⁴ = 16 • 2^(2x)

2^(2x) • 16 = 16 • 2^(2x)

Hence, since LHS = RHS, it follows that the expression is mathematically correct.

Read more on laws of exponents;

brainly.com/question/847241

#SPJ1

7 0
1 year ago
Other questions:
  • 4. On the Jackals baseball team, there are 24 right-handed players and 6 left-handed players. What is the ratio of right-handed
    15·1 answer
  • The the dimensions of a rectangular field are 23.5 meters by 15.6 meters. What is the area of the field?
    7·1 answer
  • in solving the equation for x to distribute a minus 4 on one side of the equation what needs to be done on the other side of the
    12·2 answers
  • Which equation represents a line which is parallel to x = 0?
    10·1 answer
  • I need help please the question is in the picture.
    12·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Ecuaciones con resultado 17
    14·1 answer
  • Ali studies for 3 hours 45 minutes. He started studying at 4:30 pm. At what time did he finish?
    14·1 answer
  • There are 15 balls in an urn. 5 red balls, 5 blue balls and 5 white balls. Three balls are taken simultaneously. Let X represent
    7·1 answer
  • Ansel has two family members who travel for work. Ansel’s aunt travels every 12 days. Ansel’s cousin travels every 8 days. Today
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!