1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vadim26 [7]
3 years ago
5

A large hurricane moves through a small island in the Caribbean. What are the consequences to this island's plant and animal div

ersity? (2 points)
A) The island will lose all abiotic factors needed by plant and animal

b)The island's ecosystem will recover due to primary succession.

C) The island will lose all of the plant and animal populations of the island.

D) The island will suffer a loss of native plant and animal species.
Biology
2 answers:
Rzqust [24]3 years ago
6 0

Answer: Option (D)

Explanation:Due the occurrence of a large hurricane, the island will be affected badly, where the plants will be destroyed and the number will reduced to a huge extent, and as a result of this, the animals will have to face the consequences. This will affect the food chain.

Thus, there will be a gradual loss of both plant and animal species in that island, affecting its total biodiversity.

Thus, the correct answer is option (D).

a_sh-v [17]3 years ago
5 0
D) The island will suffer a loss of native plant and animal species. Due to loss of plants the animals living in a particular area might not be able to find food to survive causing them to die eventually because of starvation
You might be interested in
Why would another parasitic organism, such as a disease-causing bacteria, be
Vaselesa [24]

Explanation:

Hey there!!

The reason is as per the characteristics of living organism, they multiply their number (replicate) and feeds on various host body.

<em><u>Hope it helps</u></em><em><u>.</u></em><em><u>.</u></em><em><u>.</u></em>

4 0
3 years ago
Why do we need to breath air instead of water????
Georgia [21]
Mainly because our lungs are made to intake air, and if we where to inhale water we would drown. oxygen can only be obtained from the air because our lungs would be able to expell the excess stuff from air easier than in water. hope i helped.
3 0
3 years ago
How did Dolly compare to sheep that were cloned with the same DNA?
vova2212 [387]

Answer:

they  have the excact same genes and every other factors as dolly

Explanation:

7 0
3 years ago
What is an acid? Select all that apply.
Leto [7]
A subtance with a pH below 7 and
<span>a substance that tastes sour</span>
7 0
3 years ago
Read 2 more answers
What is meant by the statement ""enzymes are biological catalysts""?.
Lesechka [4]

Answer:

Enzymes speed up the chemical reactions in living cells.

Explanation:

An enzyme is a biological catalyst and is almost always a protein. It speeds up the rate of a specific chemical reaction in the cell. The enzyme is not destroyed during the reaction and is used over and over.

8 0
2 years ago
Other questions:
  • Identify a structure, in organisms that do not have kidneys, that is adapted to regulate water balance.
    7·1 answer
  • In a forest, a tree falls on a swamp and kills the worm population reducing the population by half. The remaining population is
    10·1 answer
  • During the hot dry season, some species of molluscs move to shaded areas or climb structures to escape the heat from the ground.
    13·1 answer
  • How have humans increased their biotic potential and carrying capacity?
    13·1 answer
  • What was the purpose of placing the drop of distilled water onto the slide before smearing the bacterial colony onto the slide?
    5·1 answer
  • How does groundwater become polluted?
    10·2 answers
  • How does photosynthesis transforms light energy into stored chemical energy​
    13·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • Landscapes all over the world are always flat - it's called
    10·2 answers
  • The brain is encased within the ___, which is the large, superior part of the skull
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!