1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
What would happen in an ecosystem without herbivores? A. The populations of secondary consumers would decrease.. . B. The popula
lions [1.4K]
I believe the correct response is A. The population of secondary consumers would decrease, as now these organisms can't obtain energy through the food they consume which is the primary consumers as there is none and thus the population in higher tropic level dependent on them would decrease. This is the secondary consumer.
4 0
3 years ago
Read 2 more answers
Which question is most likely to be studied by biologists?
Nimfa-mama [501]

Explanation:

The question that is most likely to be studied by biologists could be "What is the effect of exercise on heart rate in horses?" since they study everything related to the Life. <em>Hope</em><em> </em><em>this</em><em> </em><em>answers</em><em> </em><em>your question</em><em>.</em><em>.</em><em> </em><em>And</em><em> </em><em>good</em><em> </em><em>luck</em><em>!</em><em> </em>

6 0
3 years ago
Read 2 more answers
Scientists have discovered a rare, ancient bacteria thriving on the ocean floor. This bacteria uses sulfur released by thermal v
Margaret [11]
Chemosynthesis is the process.
6 0
3 years ago
Read 2 more answers
Which kingdom of organisms is photosynthetic, multicellular, eukaryotic and non- motile?
Blizzard [7]

Answer:

kingdom plantae

Explanation:

They are photosynthetic multicellular organisms that are eukaryotic.

5 0
2 years ago
Why is water important, describe the special properties of water? Provide examples.
Sveta_85 [38]

Answer:

The main properties of water are its polarity, cohesion, adhesion, surface tension, high specific heat, and evaporative cooling. A water molecule is slightly charged on both ends. This is because oxygen is more electronegative than hydrogen. ... The stream of water bends due to the polarity of water molecules.

hope this helped you

3 0
3 years ago
Other questions:
  • Lipids tend to form ________
    14·1 answer
  • A chloroplast is releasing large amounts of oxygen. what does this tell you about what other processes are going on inside the c
    6·1 answer
  • Which statement best describes the distribution of Earth's natural resources?
    9·2 answers
  • 10 points and brainliest!
    12·1 answer
  • Como sabes que ADN tiene información genética
    15·1 answer
  • Explain how water is reabsorbed in the kidney?
    8·2 answers
  • Why are proteins important for organisms?
    5·2 answers
  • Which radioactive isotope would you use to date a 4-billion-year-old piece of granite?
    12·1 answer
  • Bir canlının solunum sisteminin aşağıdaki özellik-
    15·1 answer
  • What is the difference between a specialized plant cell and a specialized animal cell?​
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!