1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
2 examples of transfer by contact, induction, and conduction
Bogdan [553]

Answer: The two examples of conduction and induction are as follows.

Explanation:

Conduction can be defined as the process of transfer of charges from the charged body to the neutral body by direct contact whereas the induction is a process in which the charges are induced in the neutral body by the charge body. The conduction process requires the direct contact between the bodies in which the charges are being transmitted.

The example of the conduction process involves the neutral metal sphere gets charged when comes in contact of aluminum plate that exhibit a charge.

The example of induction is the rubbing of the rubber balloon with that of the animal fur then the two balloons will move away due to like charge repel each other.  

8 0
3 years ago
Any names of animals that start in letter "N"? any names of animals that start in letter "N"
Xelga [282]
Naja, nautile, narval
8 0
3 years ago
Mention two advantages of the extensive network of endoplasmic reticulum ​
nikklg [1K]

Answer:

Following are the two advantages of endoplasmic reticulum.

1) Endoplasmic reticulum is an organelle of the cell which is responsible for the production of protein for the cell. This protein is sent to the Golgi apparatus where it is modified and used by the cell where it is needed.

2) Endoplasmic reticulum also helps in the removal of toxic substances from the cell. If these toxic substances are not removed, it causes damage to the cell.

3 0
3 years ago
PH measurment and regulation are citrical aspect of bioprocesses?<br><br> 1.true<br> 2.false
Alisiya [41]


















False Im pretty suree
8 0
2 years ago
Maribel places her backpack and lunch bag on a lab table where there are lab materials. What is the safest way for Maribel to ar
Veronika [31]

Answer:

she should arrange them away from lab materials. She could put them to the side or under the table

Explanation:

3 0
3 years ago
Other questions:
  • What is the boiling point of pure tap water with three tablespoons of salt?
    14·1 answer
  • Court ________ would reduce the number of jurisdictions.
    14·1 answer
  • Which phrase describe NASAs goals in the coming years? Check all that apply
    5·2 answers
  • Which of the following is the path of a nerve impulse through a neuron?
    14·2 answers
  • A cross between plants that involves one characteristic is called a
    11·2 answers
  • The crystal size of an igneous rock is described as its
    12·2 answers
  • What step would likely be affected if the bacteria are exposed to this antibiotic
    11·1 answer
  • All of the plants and animals living in the same area make up a ?
    7·2 answers
  • What type of plant adaptation is a thick, woody stem? O Life cycle difference O Inherited behavior O Physical characteristic Sta
    7·1 answer
  • How to cross trihybrids
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!