1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
What rule of magnetism is illustrated by the lines of the iron filings with unlike poles?
Debora [2.8K]

Answer:

The rule of magnetism illustrated is the field lines are more concentrated at the poles and also about the direction of magnetic field.

Explanation:

  • Every magnet has two pole, north pole and south pole. The like poles repel each other and unlike poles attract each other.
  • The direction of magnetic field is from north to south that can be seen by the iron filling experiment.
  • When the iron fillings are kept near the bar magnet, we observe that most of the fillings are attached to either poles.
  • It is due to the fact that the concentration of magnetic field is highest at the poles.
6 0
2 years ago
Help me plz i need to get my grade up in biology
Kipish [7]

Answer:

B

Explanation:

3 0
3 years ago
Andy is sitting on the sofa, quietly reading a book. Which of the following is most likely supplying the majority of his energy
pentagon [3]
Option a is the right
3 0
3 years ago
A forest is cut down to make room for a housing development. Which population is most likely to survive?
Darya [45]
A because they can eat out of the trash where the others require thenforest to live. Hope this helped.
6 0
3 years ago
Read 2 more answers
When cells communicate by the signaling process, one cell produces a _________________BLANK that must be received by the _______
velikii [3]

Answer:

1. Signaling molecule

2. Signaling receptors

Explanation:

Hormones, growth factors, neurotransmitters, etc. serve the function of signaling molecules for cells. These molecules are released by one cell and bind to the receptors present on/in the target cells to elicit the desired response. Thereby, the signaling molecules serve in cell-cell communication.

For example, insulin hormone synthesized and released from beta cells of pancreas binds to its cell surface receptors present on the surfaces of liver cells and muscle cells to stimulate the uptake of the glucose from the blood.  

Likewise, neurotransmitters released from the presynaptic neuron bind to receptors present on the membrane of postsynaptic neuron and serve to carry the nerve impulse to the postsynaptic neuron.  

8 0
2 years ago
Other questions:
  • Dr. hersh treats her bipolar patients with lithium, a silvery-white mineral, as well as other _____ drugs.
    14·1 answer
  • A chemical substance that interferes with the development of bacterial organisms is
    6·1 answer
  • Take two glasses, fill one with water and leave the other empty. Place them side by side. Fold a paper towel lengthwise and put
    8·2 answers
  • What happens to the kinetic energy of a snowball as it rolls across the lawn and gains mass.
    8·2 answers
  • Why do diffusion and osmosis occur?
    7·1 answer
  • What data do meteorologist collect from the water cycle
    9·1 answer
  • precipitation _____. occurs equally all over the globe is the change in state from a gas to a liquid happens when ice changes in
    11·2 answers
  • _______and_______process help in balancing of carbon dioxide and oxygen in the environment​
    5·1 answer
  • Sustancia que regula la temperatura del cuerpo, ayuda a llevar nutrientes y oxígeno a las células, convierte los alimentos en en
    13·1 answer
  • You are riding in a car and speed up. What are the possibilities for the acceleration that your car undergoes? (Select all that
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!