1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
7th grade Complete the following analogy:
meriva

Answer:

B

Explanation:

4 0
3 years ago
Which of these is an example of an achieved status? a. African American b. daughter c. adolescent d. husband
algol13

Which of these is an example of an achieved status? d. husband

6 0
3 years ago
What happens to the water after it rains
Dahasolnce [82]
This questions seems like its missing other parts 
7 0
3 years ago
In a DNA sample, 15% of the bases are thymine (T). What percentage of the bases in this sample are adenine (A)
Marizza181 [45]
In DNA, thymine binds to adenine, and cytosine binds to guanine. This means that there is an equal amount of thymine and adenine, and there is an equal amount of cytosine and guanine. 

If there is 15% thymine, there should be 15% adenine.

Note that in real life, the percentage of bases won't be 100% equal. 
3 0
3 years ago
Each nucleotide of rna contains what type of sugar
Lady_Fox [76]

Like DNA, RNA polymers are make up of chains of nucleotides. The sugars they are made up of; a five carbon ribose sugar.

Or Pentose Sugar.

3 0
3 years ago
Read 2 more answers
Other questions:
  • Do kangaroos drop their babies when they run away
    6·1 answer
  • What is the weakest part of a chicken its for a project
    9·1 answer
  • Oque garante a algumas plantas a capacidade de atingir grande altura?
    5·1 answer
  • How do you call a balance in which the rate of change in one direction is equal to the rate of change in another?
    6·1 answer
  • When pink snapdragons are crossed with white snapdragons, what color will the offspring be?
    10·2 answers
  • How does biology relate directly to your own life?
    5·1 answer
  • Ms. Jones is teaching her class about rocks and minerals. She holds up a rainbow chocolate chip cookie and explains that the coo
    12·2 answers
  • Please helppppp ASAP like right now I mark you Brainliest
    8·2 answers
  • A _____ that is placed to the right of the element's symbol tells how many atoms of that element are in the formula.
    8·1 answer
  • 5. Asteroids and comets are both objects that orbit the sun.
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!