1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
What are the functions of the muscular system?
vaieri [72.5K]

As you have probably guessed, the main function of the muscular system is movement, but it also helps stabilize our joints, maintain our posture and generate heat during activity. Movement of our body can be voluntary and controlled by the skeletal muscles, or it can be involuntary and controlled by smooth muscles.

3 0
4 years ago
Read 2 more answers
Mendels law of independent assortment is likely to be observed for
Rom4ik [11]

Answer:

ExIndependent Assortment. Mendel's law of independent assortment states that genes do not influence each other with regard to the sorting of alleles into gametes: every possible combination of alleles for every gene is equally likely to occurplanation:

8 0
3 years ago
Which action could help you to increase your metabolic rate?
makkiz [27]
Body temperature, Environmental temperature, Body mass, Reproductive condition, Activity, Feeding, Body condition, Season. All of these would help increase it. Hope this helps. :)
6 0
3 years ago
The body of tapeworm is segmented but it doesnot belong to phylum annelidai why​
Wewaii [24]

Answer:

look

Explanation:

Flatworms, roundworms, and segmented worms are all invertebrates. Some species of each type of worm are free-living, meaning they are not dependent on another organism.Some are parasitic.

Flatworms belong to phylum Platyhelminthes. They do not have a coelom, respiratory system or a circulatory system.Tapeworms flukes are examples of flatworms.

Roundworms are part of the phylum Nematoda. They are bilaterally symmetrical invertebrates.They have a psuedocoelom. Ascaris lumbricodes is the most common human parasite.

Segmented worms are the most complex animals of these three invertebrates. They are placed in Annelida. Segmented worms have a true coelom, a circulatory system and a digestive system.An earthworm is a segmented worm.

7 0
3 years ago
In this lab, we assumed that the only acid in our juice sample was citric acid, but other acids may be present as well. Ascorbic
gregori [183]

Answer:

The presence of other acids in our juice causes our calculated concentration of citric acid to be falsely high.

Explanation:

The presence of other acids in our juice causes our calculated concentration of citric acid to be falsely high and we would have to account for the other acids in this case.

5 0
3 years ago
Read 2 more answers
Other questions:
  • What's the meaning of bio​
    8·1 answer
  • What is the location of the parotid lymph node?
    15·1 answer
  • Do humans impact Earth's climate?
    10·2 answers
  • If decomposers were removed from an ecosystem, what would be the most likely effect?
    5·1 answer
  • What is stem cell?
    6·2 answers
  • The mass extinctions that occurred 250 million years ago and 65 million years ago may have been due to gradual processes or
    8·2 answers
  • The term "baby boom" refers to a significant increase in _______.
    11·1 answer
  • BRAINLYIST PLSSSS HURRY
    5·2 answers
  • Hebdnenxndjwlsjdnejfnhcjrnfnfofnfjfnbfif
    10·1 answer
  • I will give you brainliest<br> what does exercising do
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!