1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
An empty 1,000.-milliliter container has a mass of 250.0 grams. When filled with a liquid, the container and the liquid have a c
Brrunno [24]
The   answer    to   the    question    is    10.430
8 0
3 years ago
Explain how the ratio of elements in a compound is related to the compound’s properties.
abruzzese [7]

Answer:

A compound is made up of atoms of different elements combined together in a chemical reaction with fixed ratio and in a defined manner via chemical bonding.

Elements on the other hand are pure chemical substance made of same type of atom.

The properties of the compound is related to the ratio of elements in a way that the elements individual properties will manifest itself in the compound giving it a hybrid property.

4 0
3 years ago
Which is the BEST research question for students to ask if they are conducting research on antibodies?
steposvetlana [31]

How does the immune system produce memory cells for antigens?

This is the BEST research question for students to ask if they are conducting research on antibodies because t<span>he answer to this question must tell about production of B-cells, recognition of antigen, T-helper cells, colony formation, and phagocytosis of foreign antigen, T-killer cells, and all other details which is possible.</span>

8 0
3 years ago
What is the answer?
Ahat [919]

Explanation:

1. Apple is to pear as Lemon is to lime

5.No is to yes as Disagree is to Approve

(Those are the only ones I can think of rn my brain is sort of fried and has been since August)

6 0
3 years ago
BIOLOGY Biolgy Biology biology bology BiOlOgY BIOLOGY Biolgy Biology biology bology BiOlOgY BIOLOGY Biolgy Biology biology bolog
frutty [35]

here ya go bud https://youtu.be/dQw4w9WgXcQ

7 0
3 years ago
Read 2 more answers
Other questions:
  • What organelle releases energy for metabolic activity in a nerve cell
    6·1 answer
  • Need Help Asap
    13·2 answers
  • Why are plants green?
    7·2 answers
  • One of the functions of the skeleton is to produce blood cells.<br><br> True<br> False
    13·1 answer
  • What is the function of the waxy cuticle of plants?
    13·1 answer
  • An organ that helps break down food but is not part of the tube through which the foodstuffs pass is referred to as a(n) _______
    5·1 answer
  • We use electrical devices that produce motion, light, and sound. Which aspect of energy explains why these devices are possible?
    11·1 answer
  • Which of the following factors limits the abilities of populations within an ecosystem to survive?
    7·2 answers
  • Which of the following represents a way that animals in a zoo are influenced by their environment?
    7·2 answers
  • Which two main gases make up the atmosphere
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!