1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
Describe the process that paleontologists use to find fossil and the challenges involved that would support Darwinism idea
solniwko [45]
DNA testing and if they have certain strands that we dont
7 0
3 years ago
An enzyme _____. is an organic catalyst is a inorganic catalyst can bind to nearly any molecule is a source of energy for enderg
Sidana [21]

An enzyme is an organic catalyst.

<h3>What is an enzyme?</h3>

Enzymes are proteins that help speed up metabolism or the chemical reactions in our bodies.

They build some substances and break others down.

All living things have enzymes. Our bodies naturally produce enzymes.

But enzymes are also in manufactured products and food.

Examples of specific enzymes:

Amylase: In the saliva, amylase helps change starches into sugars.

Maltase: This also occurs in the saliva, and breaks the sugar maltose into glucose.

Trypsin: These enzymes break proteins down into amino acids in the small intestine.

To learn about enzymes, refer

https://brainly.in/question/15327487

#SPJ4

4 0
1 year ago
Which biome has low rainfall
koban [17]

A <u>desert</u> receives less than 10 inches, or 25 centimeters, of precipitation a year.

4 0
3 years ago
Science help thank you
DaniilM [7]

Answer:

I think it's d

Explanation:

I remember from a couple years ago I had to answer a question similar to this. I'm 90% sure I chose the last answer.

only choose my answer if you agree.

4 0
3 years ago
Instead on having roots and leaves molds grow as thread like filaments called
Pavlova-9 [17]
Hyphae - it’s typically the main way of vegetative growth and collectively it’s called the mycelium. Occurs in yeast and fungi
7 0
3 years ago
Read 2 more answers
Other questions:
  • Enzymes catalyze chemical reactions that keep cells alive. imagine that a cell had no enzymes. how would having no enzymes affec
    14·1 answer
  • How could a substance that stops the synthesis of mRNA cause the liver to stop functioning (the death of liver cells)?
    5·2 answers
  • WILL GIVE BRAINLIEST!!Thank you
    11·2 answers
  • You've been experiencing acid indigestion lately, and you'd like a quick fix for the problem. You do a little research on the In
    8·1 answer
  • А<br> is an agent that can cause infections and diseases.
    7·2 answers
  • During the time of Aristotle, people believed that nonliving matter produced living things. What is the term for this idea?
    9·1 answer
  • Which of the following is not a true statement:
    13·2 answers
  • Over time, what will to happen to the populations of light and dark moths on light trees?​
    14·1 answer
  • Why wasn’t oxidation type chemical weathering common more than 2 billion years ago
    8·1 answer
  • Ocean salinity varies from place to place due to differing conditions in the environment
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!