1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
Why are waves an important feature of the ocean surface?
emmainna [20.7K]
Waves are an important feature of the ocean surface because they balance climates by regulating surface tension on the water.
3 0
3 years ago
Which process will be immediately inhibited if cytochrome c is unable to interact with cytochrome c oxidase
bonufazy [111]

Answer:

Electron transfer to from cytochrome c to molecular Oxygen in the process of oxidative phosphorylation

Explanation:

Cytochrome c is a protein which is involved in the electron transport chain for the production of ATP molecules during then process of respiration. It a soluble protein found in the intermembrane space of the mitochondria. It receives electrons from ubiquinone at Complex III of the electron transport chain and transfers this electron to molecular oxygen through its interaction with complex IV or cytochrome c oxidase, reducing molecular oxygen to water.

If the interaction of cytochrome c with cytochrome c oxidase is inhibited, the process of elctron transfer to oxygen will be inhibited and, so ATP synthesis will cease.

Ultimately,  respiration will be inhibited resulting in death of the organism. For example, cyanide inhibits cytochrome c oxidase resulting in death of the organism poisoned with cyanide.

4 0
3 years ago
The energy used for active transport comes from the _____.
DIA [1.3K]
Answer is A.cell membranes
7 0
3 years ago
Read 2 more answers
What is one role of ATP in the light independent reaction of photosynthesis
rodikova [14]
ATP supplies the energy to produce glucose and other carbohydrates. In the chemical equation for photosynthesis, carbon dioxide and water are converted to glucose and oxygen.
8 0
3 years ago
Which of the following adaptations allowed plants to transport water and nutrients to all of the plant's cells?
Sladkaya [172]
<span>Plants have evolved several adaptations to life on land, including embryo retention, a cuticle, stomata, and vascular tissue.

Don't know if this is what your were looking for..
</span><span />
4 0
4 years ago
Other questions:
  • Level ___ is used when nuisance contamination is present only requiring the lowest form of chemical and/or respiratory protectio
    5·2 answers
  • Which measurement unit represents volume?
    12·2 answers
  • What is NOT true regarding viruses that infect plants? Group of answer choices
    14·1 answer
  • This is the last part of the cell cycle. This is process in which the cytoplasm is divided between the two new daughter cells.
    6·2 answers
  • Structures in plant leaves that open and close to maintain homeostasis are stomata
    11·2 answers
  • Which of the following would be a good hypothesis for this experiment? If the surface of the floor material is changed, then the
    6·1 answer
  • Generally speaking, identify the overall structure<br> of the cell membrane?
    9·2 answers
  • Can some one helpppppp plssss
    7·1 answer
  • Which of the following aspects of the environmental movement addresses the public’s right to intervene in environmentally damagi
    15·1 answer
  • New techniques to produce cells with the characteristics of embryonic stem cells include?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!