1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
Which compares prokaryotes and eukaryotes?
Eduardwww [97]

Answer:

The correct answer is C

Explanation:

Hope this helps!

4 0
2 years ago
Read 2 more answers
After our sweat mixes with our skin bacteria and we don’t shower soon, the result is
enyata [817]
When you aren't showering as regularly, your skin can become oily and salty leading to blemishes and breakouts. Although your skin can get all sweaty during the day anyway, not bathing means these bacteria are not being thoroughly removed or cleaned.
6 0
3 years ago
A(n) _____ is a value that is defended in order to maintain homeostasis.​
MaRussiya [10]
B. because a metabolism is the breaking down of food reacting in chemical actions including homeostasis.
7 0
2 years ago
Aresearcher is studying cells. They are currently focusing on a cell with 22 chromosomes . how many chromosomes would be in this
Sidana [21]

Answer:

11 chromosomes.......

6 0
3 years ago
Please answer this I need to know. Why am I alive and lonely
Vladimir79 [104]

Answer:

I Feel Lonely: What To Do When You're Feeling Alonewww.psychalive.org › isolation-and-loneliness

When we are lonely, we are more likely to see things as hopeless. ... There are actions you can take to combat feeling alone and begin to have more ... Because our brains do not respond positively to seclusion, place yourself in social ... PsychAlive PsychAlive is a free, nonprofit resource created by the Glendon Association

Explanation:

4 0
2 years ago
Read 2 more answers
Other questions:
  • Provide TWO reasons why the genotype and phenotype frequencies do not match in the Tadjik population. (Hint: Think about the met
    8·1 answer
  • Which of the following is not a characteristics of life
    13·2 answers
  • What might be the result if a person's occipital lobe was damaged?
    10·1 answer
  • Select ALL the correct answers.
    8·1 answer
  • What is the scientific method and how do scientists use it to address environmental problems?
    6·1 answer
  • Which surface erosion event does the most short- term damage?
    10·1 answer
  • -
    9·2 answers
  • Why is the luangwa valley sparsely populated​
    14·1 answer
  • Using the diagram shown, what season would be happening in Texas at position 4? (Texas is in the Northern Hemisphere)
    7·1 answer
  • Why do biologists measure the number of trophic levels in an ecosystem?
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!