1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
spin [16.1K]
3 years ago
8

Recall that DNA and RNA are synthesized only in the 5'→3' direction and that DNA and RNA sequences are written in the 5'→3' dire

ction, unless otherwise noted.
Consider the following DNA sequence:
5' TTGAAATGCCCGTTTGGAGATCGGGTTACAGCTAGTCAAAG 3'
3' AACTTTACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

Part A) Identify bases in the bottom strand that can be transcribed into start and stop codons. Write the mRNA sequence (in the form of triplets, for example, GGG-AAA-CCC) that would be transcribed between start and stop codons if the bottom strand served as the template for RNA polymerase.

Part B) Write the amino acid sequence that would be translated from the mRNA sequence you just wrote.

Enter your answer using 3-letter abbreviations for amino acids as in the example: Val-Arg-Ser-Trp
Biology
1 answer:
aleksley [76]3 years ago
8 0

Answer:

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

Explanation:

Transcription is a process which transcripts the DNA to a molecule called mRNA or messenger RNA which contains code for the synthesis of amino acids.

The RNA nucleotide base pairs are added in the same way as in the DNA that is guanine will bind cytosine but adenine will bind uracil instead of thymine.

Since the start codon is AUG which codes for methionine and stop codons could be UAG, UAA or UGA which do not code for the amino acids during translation.

In the given question,  

Looking for the start codon which is AUG in the template strand is found and the transcript mRNA thus will be coded as

<u>Template strand</u>

3' AACTT-TACGGGCAAACCTCTAGCCCAATGTCGATCAGTTTC 5'

<u>The Transcription mRNA</u>

5'- AUG-CCC-GUU-UGG-AGA-UCG-GGU-UAC-AGC-UAG-3'

<u>The translation product</u>

5' Met-Pro-Val-Trp-Arg-Ser-Gly-Tyr-Ser-3'

You might be interested in
Which term refers to a group of organisms that are known to be discontinuous with each other?
hammer [34]

The Term is called Niche Full distance of physical and biological setting in which an organism lives and the way in which the organisms uses those conditions. Causing species to divide resources, competition helps determine the number and kinds of species in a community and the niche eacthcies occupies.

<span> </span>

5 0
3 years ago
Help in biology.............................................
weeeeeb [17]

Answer:

kingdom fungi

Explanation:

it is definitely kingdom fungi

8 0
3 years ago
Earth makes one full rotation on its axis approximately every 24 hours. If Earth's period of rotation decreased to 20 hours, whi
patriot [66]

Answer:

The length of daylight and nighttime would decrease.

Explanation:

If 24 hours was decreased to 20, it would shorten night and day time.

5 0
3 years ago
What compares the number of events that occurred to the total number of possible events.
Dmitrij [34]
I THINK!!! a. but i could be wrong sry if i am
8 0
3 years ago
What are three environmental hazards associated with the process of extracting fossil fuels?
PIT_PIT [208]

B D E.

It right dont question it

8 0
3 years ago
Read 2 more answers
Other questions:
  • 1. Is the trachea considered an organ? <br> 2. Are bones organs?<br> 3. What are rigid organs?
    10·2 answers
  • Which statement is true for both plant and animals cells?
    13·2 answers
  • In living things, cells must be in a(n) ___________ solution where water leaves and enters the cell at the same rate
    6·1 answer
  • Which two elements share similar properties?
    6·1 answer
  • How are family trees of organisms created?
    11·1 answer
  • What molecule is needed for photosynthesis to occur?
    14·1 answer
  • Which process temporarily disrupts homeostasis because it increases an already high concentration of chemicals in the cell?
    15·2 answers
  • Which is the most likely explanation for the presence of 13 different finch species on the
    15·1 answer
  • describe one piece of evidence represented by the contour line on the map that indicates the north side of chimney bluffs is ste
    15·1 answer
  • Many living things depend on
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!