Answer:
The concentrations of KCl and NaCl will tend to be equilibrated in both sides, until there is no more movement in any direction.
Explanation:
Since this is an artificial membrane, the concentration of both substances in both sides, will tend to be the same, this is just the answer to a physical distribution of the concentration of the substances.
In natural membranes, this is not like this because all the living things need to have a movement of these minerals to activate the electric response, this happened by the action and help of some carriers because is an active process, that means, need energy and some other carriers to move the compounds from one side to another.
Hope this info is useful.
Answer:
Plants are a good starting point when looking at the carbon cycle on Earth. Plants have a process called photosynthesis that enables them to take carbon dioxide out of the atmosphere and combine it with water. Using the energy of the Sun, plants make sugars and oxygen molecules
Explanation:
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
Answer:
Disadvantages
Primarily made from non-renewable sources including fossil fuel
Provide nutrients to plants but nothing to sustain soil
Chance of over fertilization, that may damage crop and entire soil ecosystem
Leaching and move to rivers and sea causing eutrophication
Repeated application may lead to toxic build up of arsenic, cadmium etc in soil that may be present in fruits and vegetables.
Advantages:
•rapid action
•Constituent ratios defined
Explanation: