1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Pani-rosa [81]
3 years ago
13

While snorkeling you come across an organism that appears to be a mollusk. In an effort to identify the type of mollusk you make

the following observations: fast moving, large eye. What type of mollusk do you believe you have found
Biology
1 answer:
Sergio [31]3 years ago
4 0
A squid or some type of squid since they belong to the mollusk family.
You might be interested in
HURRY IM IN A QUIZ! PLEASE ANSWER! In which kingdom do all organisms have cells that like a cell wall
e-lub [12.9K]

Answer:

fungi and bacteria and plants if its just one answer fungi

Explanation:

8 0
3 years ago
Read 2 more answers
- Key Concept Describe the<br> functions of the cell membrane<br> and cell wall.
STALIN [3.7K]
Cell wall protects the cell from bursting or shrieking. (maintains the shape of a cell) While cell membrane regulates the entry of substances into the cell and exit from the cell wall.
6 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
How do you use active transport in a sentence
sergey [27]
Active transport is the process in which substances are absorbed against a concentration gradient, i.e. from a lower to a higher concentration.
7 0
3 years ago
PLEASE HELP ASAP!!! I WILL GIVE BRANLIEST!!!
Anarel [89]

Answer:

Cohesive forces are responsible for surface tension, a phenomenon that results in the tendency of a liquid’s surface to resist rupture when placed under tension or stress. Water molecules at the surface (at the water-air interface) will form

Adhesion and cohesion are water properties that affect every water molecule on Earth and also the interaction of water molecules with molecules of other substances.

Explanation:

6 0
3 years ago
Read 2 more answers
Other questions:
  • WILL GIVE BRAINILIST
    5·1 answer
  • What is the expression of the gene makeup or appearance of the individual called?
    10·1 answer
  • A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a t
    10·1 answer
  • Mammals in Australia are called marsupials, and diverged from the placental mammals very early in mammalian evolution. Australia
    8·1 answer
  • The earth's oceans are made up of _______, ________, chlorine, and trace elements. A) carbon, oxygen B) oxygen, silicon C) hydro
    9·2 answers
  • List six charateristics of living things
    10·1 answer
  • Select all of the following that plants
    7·1 answer
  • How can recessive traits have a higher cell count than dominant traits?
    11·1 answer
  • Simplify the combined equation for photosynthesis by crossing out compounds that are both products and reactants. How does this
    8·1 answer
  • The formation of the many kinds of body cells that make up an embryo begins with
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!