1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Nitella [24]
2 years ago
8

Decreasing levels of ____________ lead to sloughing, or shedding, of the endometrial lining.

Biology
1 answer:
Nimfa-mama [501]2 years ago
6 0
<span> the answer is progesterone
hopes this helps
</span>
You might be interested in
The stem cells of plants have an unusual tubular structure unlike most other types of plant cells. What function of plant stem c
Shtirlitz [24]
The tubular structure allows for faster and easier transport of nutrients between the roots and the rest of the plant.

Answer: Transport

Any questions?
6 0
3 years ago
Explain how the processes of sea-floor spreading and magnetic reversal produce bands of oceanic crust that have different magnet
WARRIOR [948]

Explanation:

As the two plates move away from each other in a divergent boundary, the magma from the mantle beneath rises to replace the void created. The magma then cools into a new crust. Before the magma cools, the iron minerals align themselves with the magnetic fields of the earth due to their ferromagnetic properties. These cause the rocks after they are cooled to seem to have bands.

Due to magnetic reversals of the earth's magnetic fields (i.e change in magnetic north and south poles) over several hundred thousand years, these bands will orient differently depending on the then earth magnetic polarity when the magma was cooling.

Learn More:

For more on seafloor spreading check out;

brainly.com/question/3616698

LearnWithBrainly

4 0
3 years ago
Why are the geochemical and biogeochemical cycles so important? A.Keeps volcanoes from erupting so often. B.Maintains oil deposi
AleksAgata [21]
C) would be the answer. I just did a test w/ this question and I picked C) and got !00%
4 0
3 years ago
Read 2 more answers
Describe in a short paragraph how the following terms work together in an ecosystem and which of the terms can be used to includ
podryga [215]
Trophic level: the feeding level of an organism in a food web or chain. Food web: a diagram showing a series of interconnected food chains and the flow of energy through an ecosystem. Food chain: a diagram showing the flow of energy from one trophic level to the next. E.g. Consumer or decomposed Consumer: an organism which feeds on other organisms to obtain its nutritional requirements (part of a food web/chain). Producer: an organism capable of trapping the suns energy and converting it to sugar in the process of photosynthesis. Therefore the term food web is the term used to include all of the above. 
hope this helps, :)
4 0
3 years ago
Read 2 more answers
During which stage of meiosis do synapsis and the formation of tetrads occur?'
mylen [45]
"Prophase I" is the stage of meiosis that synapsis and the formation of tetrads occur.
8 0
2 years ago
Other questions:
  • What does the cave art in koonalda cave signify about human culture at the time?
    13·1 answer
  • If closely related horses are inbred,predict the outcome
    8·1 answer
  • Unequal crossing over during Prophase I can result in one sister chromosome with a deletion and another with a duplication. A mu
    14·1 answer
  • Which diagram correctly displays the order of events during egg formation?
    5·2 answers
  • What was a positve aspect of interaction between French settlers and American Indians?​
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Consider the skeleton.
    12·1 answer
  • What might be the consequences of your choice? <br> • Political:<br> • Economic:<br> • Social:
    8·2 answers
  • Every ____ has a specific _____
    15·1 answer
  • The large intestine connects with the small intestine at the.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!