<span>The ischemic penumbra can maintain metabolic demand with marginal blood flow from collateral circulation for a maximum of 50% before increasing in size. A penumbra is the area where the flow of blood at about 25 - 50% can maintain normal metabolic demands for 6 - 8 hours only. When it continues to increase, the human cells will die and other neurological activity will be suspended causing the person to die slowly.</span>
Answer:
Antibiotic resistance happens when germs like bacteria and fungi develop the ability to defeat the drugs designed to kill them. That means the germs are not killed and continue to grow. Infections caused by antibiotic-resistant germs are difficult, and sometimes impossible, to treat.
Explanation:
hope this helps:)
The zonation of flora and fauna along an altitudinal transect similar to that found along latitudinal transects is an expression of the the life zone concept.
<h3>What is life zone concept?</h3>
- C. Hart Merriam created the term "life zone" in 1889 to refer to regions with comparable plant and animal groups. Depending on height, location, and latitude, the climate and ecology of many places on the planet naturally divide into life zones.
- Altitudinal zonation is the term for the generally substantial dependence on elevation: the average temperature of an area falls as the height increases.
- The US has thirty-eight life zones, including one boreal, twelve cool temperate, twenty warm temperate, four subtropical, and one tropical (34% of the world's life zones and 85% of the temperate ones).
Learn more about the life zone with the help of the given link:
brainly.com/question/895846
#SPJ4
Full question attached
Answer/ Explanation:
The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.
<h3>Original DNA</h3>
GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
<h3>_______________________________________________</h3><h3>Mutated DNA</h3>
GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG
RNA
CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC
tRNA
GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG
This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein
