1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
REY [17]
3 years ago
15

A material that has_____can be split fairly easily along planes with weak atomic attraction

Biology
1 answer:
rewona [7]3 years ago
4 0
B, cleavage is your answer
You might be interested in
Why do farmers spray pesticides and insecticides in the field​
denis23 [38]
Answer:

Farmers utilize pesticides to help control the thousands of weed species, harmful insects, and plant diseases that can afflict crops, period. ... Pesticides don't only affect food crops though; production of certain fibers and oils would also be affected, as crops like cotton are highly susceptible to pests and disease.

Explanation:
6 0
2 years ago
According to the phylogeny tree, which two phyla are most closely related?
bonufazy [111]
The answer I came up with is Echinoderms and Chordates.

Happy studying!
8 0
3 years ago
Read 2 more answers
HELP FAST! PHYSICAL SCIENCE salt is added to a flask of water. the flask is sealed and shaken for several minutes.After being sh
densk [106]

Answer:the following can be done to allow more NaCl to dissolve;

1.) heating the mixture.

2.) Addition of extra water to the solution.

Explanation:

When sodium chloride is dissolved in water, the polar water molecules are able to work their way in between the individual ions in the lattice. The water molecules surround the negative chloride ions and positive sodium ions and pull them away into the solution. This process is called dissociation. Now when the solution is heated, the rate of the dissociation between the two molecules increases leading to more dissolution of NaCl. Also in the absence of heating, more Water molecules can be added to the solution to decrease it's saturation thereby favouring the dissolution of more NaCl.

6 0
3 years ago
Leaves attach to stems at nodes t or f
aleksandrvk [35]
True, all leaves at them stem calling the process "Nodes"
5 0
3 years ago
Cells that do not contain nuclei are known as
tensa zangetsu [6.8K]
Prokaryotic cells because they don't have a nuclei.
3 0
3 years ago
Other questions:
  • On a backpacking trip, Kenny hikes all day at a steady pace, covering 30 kilometers and burning 4000 Calories. At the school tra
    12·1 answer
  • Which of the following is a description of a rescource that belongs to a country with a high carrying capacity?
    7·2 answers
  • Does Eukaryotes, fungi,both, or none. Have a membrane-bound nucleus ?
    12·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Mechanoreceptors that react to changes in pressure are part of the _____
    12·2 answers
  • Which image most likely represents muscle structure?
    11·1 answer
  • A section of a nucleic acid is shown below. The process represented in the diagram produces a molecule that is complementary to
    15·1 answer
  • What type of molecules pass directly through the membrane? (Passive transport)
    14·1 answer
  • Can someone please help me meee
    9·2 answers
  • Differences and similarites on photosynthesis and cellular respiration
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!