1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tiny-mole [99]
3 years ago
8

How can two parents who show the dominant trait have offspring who shows the recessive trait? Give an example to support your an

swer. Be sure that your answer includes appropriate vocabulary terms
Biology
1 answer:
natta225 [31]3 years ago
7 0

Answer:

One example of a recessive inherited trait is a smooth chin, as opposed to a dominant cleft chin. Let (S) represent the dominant allele, and (s) represent the recessive allele. Only (ss) individuals will express a smooth chin. To determine the probability of inheritance of a smooth chin (or any other recessive trait), the genotypes of the parents must be considered. If one parent is heterozygous (Ss) and the other is homozygous recessive (ss), then half of their offspring will have a smooth chin.

Explanation:

You might be interested in
What are some examples of bodily functions that require ATP (Active Transport) to move molecules in and out of cells?
Firdavs [7]
Cellular Respiration
4 0
3 years ago
Plants and animals that live in estuaries face a dilemma in maintaining water balance inside their cells. During high tide they
jok3333 [9.3K]

Answer:

The correct answer is "a hypertonic solution".

Explanation:

Seawater is the most clear example of a hypertonic solution in nature. The concentration of ions in seawater are far more superior than the concentration of ions inside a plant or an animal cell, since seawater have an osmolarity of about 1000 mOsm/l. Therefore, at high tide a plant or animal cell will be in a hypertonic solution, and the cells must have adaptions to avoid cell shrinking and dead.

6 0
3 years ago
Luteinizing hormone is bound to transport proteins in the plasma. <br> a. True<br> b. False
Tanzania [10]

Answer:

FALSE

Explanation:

Luteinizing hormone, also known as the lutropin, is a heterodimeric glycoprotein produced by the gonadotropic cells of the anterior pituitary gland.

The function of the luteinizing hormone in males is the secretion of the progesterone hormone. Whereas, in females, the acute rise of this hormone triggers ovulation, maintains the corpus luteum and is also responsible for the secretion of progesterone hormone.            

4 0
3 years ago
What is the application of genetics in medicine ​
never [62]

Genetic applications in medicine can include studies of inheritance, mapping disease genes, diagnosis and treatment, and genetic counseling.

4 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
Other questions:
  • Hazardous wastes are characterized by being mainly ________. most hazardous wastes come from ________.
    7·1 answer
  • Could anyone help me please?
    8·1 answer
  • A yellow fever mosquito has 3 chromosomes in its eggs. how many chromosomes does it have in its wing cells
    14·1 answer
  • Your are looking at muscle cells under a microscope from the thigh of a long distance runner. Which organelle(s) would you expec
    9·1 answer
  • What occurs when too much of a population relys on something.
    8·2 answers
  • I want to go to 9th grade plz help
    8·1 answer
  • What is uniformitarianism?
    12·1 answer
  • One main difference between a pine tree and an arctic fox is..?
    15·2 answers
  • ATP is a(1 point)
    9·1 answer
  • Antimicrobiano solutions with water as the solvent are called what solutions, whereas anti microbial solutions with alcohol or w
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!