Answer:
Explanation:
The third-quarter moon, also known as the last quarter moon, rises around midnight and sets around noon. Crescent Waning From our vantage point, the Moon is nearly back to the point in its orbit where its dayside directly faces the Sun, and all we see is a thin curve
When you look at a waxing crescent moon, you see a thin fraction of the moon's illuminated side and a larger fraction of the moon's night side, which is submerged in the moon's own shadow. Earthshine on a waxing crescent moon
The Decline The Gibbous phase occurs when the illuminated portion of the Moon decreases from 99.9 percent to 50.1 percent. It begins shortly after the Full Moon and continues until the Third Quarter Moon. Waning refers to the fact that it is shrinking and becoming smaller, whereas gibbous refers to the oval-to-round shape.
Hope this helps you!
Answer:a stationary front.
Explanation:
they allow repeated thunderstorms to move across the same area.
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
A factor of an experiment is a controlled independent variable; a variable whose levels are set by the experimenter. A factor is a general type or category of treatments. Different treatments constitute different levels of a factor
An experiment has several types of variables, including a control variable (sometimes called a controlled variable). ... A control variable is another factor in an experiment; it must be held constant. In the plant growth experiment, this may be factors like water and fertilizer levels.
Explanation:
