1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Ira Lisetskai [31]
3 years ago
15

What are two key characteristics of a good scientific investigation?

Biology
1 answer:
Afina-wow [57]3 years ago
6 0
Two key characteristics of a good scientific investigation are hypothesis and observation of whatever organism your studying.
You might be interested in
A cell is placed in an isotonic solution. How does the cell maintain homeostasis in this environment?
Mandarinka [93]

Answer:

C

Explanation:

Because of meiosis and mitosis, the water will move across the cell membrane to the inside of the cell.

4 0
3 years ago
You’re doing a clinical at the local hospital when you meet Mr. T, a 23-year-old man who has suffered a complete spinal injury a
tankabanditka [31]

Answer:

In the given case, it is clear that the sympathetic part of the autonomic nervous system is on in Mr. T. It can be suggested due to the increase in heart rate and appearance of cold and pale skin in the patient's upper body. The sympathetic nervous system is the component of the ANS, which is an extensive network of neurons that monitor's the involuntary processes of the body.  

Mainly, the sympathetic nervous system monitors the features of the body associated with the fight or flight response like increasing heart rate, mobilizing fat reserves, and discharging adrenaline. Apart from this, the increased heart rate and vasoconstriction will assist in elevating the patient's blood pressure.  

5 0
3 years ago
Drag each label to the correct location on the chart.
Allisa [31]

#1: Bias

#2: Fact

#3: Bias

# 4: Bias

#5: Fact

#6: Fact

BIAS: Tomatoes taste better when fish

DNA is inserted into them. Cereal is more

filling when cow DNA is inserted into it.

Testing GMO on rats and cockroaches

is ethically wrong.

FACT: Genes from different species can

be spliced into an organism to produce

desired traits. GMO crops can be

designed to grow in environments where

the natural species can't grow. The genes

from GMO plants can spread to natural

species if they successfully mate.

Hope this helps! :)

6 0
3 years ago
Read 2 more answers
According to the theory of plate tectonics what drives the motion of the contenients
Elanso [62]
The theory of tectonic plates explains that large convectional currents occuring in the mantle(as a result of magma) are the reasons plates,and so continents,are moved. Note movement occurs in the boundary in between the plates.
7 0
2 years ago
Read 2 more answers
Contributing factors that lead to Xenophobia
Furkat [3]
Sorry its a very long answer-
1.) Failure to maintain the rule of law
The government's repeated failures to bring levels of violent crime under control contributed to an environment which saw people resort to violence without fear of arrest or successful prosecution.
2.) Border control

3.) Corruption

4.) Employment

5.) Education
This has been government's biggest failure and carries much of the blame for the high unemployment levels. It is arguable whether current state education is in its totality any better than that under apartheid. Only 1% of black matriculants achieve a good HG maths pass.
The education system is a good example where policy failures in one area compounded those in another.
6.) Slowing economic growth
7.) Foreign policy

8.) Service delivery

9.) Race relations
3 0
3 years ago
Other questions:
  • Drag the tiles to the correct boxes to complete the pairs.
    13·1 answer
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • If someone asked you how wide your desk is, how would you measure it? Would you measure using inches, centimeters, feet, yards,
    7·1 answer
  • Describe whale evolution
    7·1 answer
  • 1. List the distances between each pair of genes:
    6·1 answer
  • Organelles are what structures within a living cell?
    6·1 answer
  • In science, evidence =<br> Ideas<br> Opinions<br> Fake news<br> Numbers
    14·1 answer
  • Identify the effects of the disorders that weaken the immune system. 1.There is a decrease in the production of . 2.Immune cells
    5·2 answers
  • What is immigration?
    12·1 answer
  • What's the difference between human skin and the cell membrane !! I WILL MARK AS BRAINLIEST
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!