2................................................
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
Ans.
Lac (lactose) operon in a type of bacterial operon, which shows a cluster of genes that are regulated by a single promoter. It is composed of an operator, promoter, a terminator, and three structural genes (lacA, lacY, and lacZ), which are responsible for the transport and breakdown of lactose.
The lac operon is an inducible operon as it gets activated in the presence of lactose and expressed its functional genes in the form of proteins (or enzymes) for lactose metabolism.
Thus, the correct answer to be fill in first blank is 'inducible' and in second blank is 'lactose.'
In terms of human evolution, the sagittal crest was usually more pronounced and larger in older and robust species compared to younger or gracile species.
Hope that helped! :)
Answer:
Obstructive shock.
Explanation:
Obstructive shock may be defined as the shock that are associated with the physical obstruction of the vessels of the heart. The cardiac tamponade and Pulmonary embolism are included under obstructive shock.
Thrombosis is the blood clot formation in the blood vessels. This has caused the pulmonary embolsim. This is referred as obstructive shock as the heart vessel has been damaged in this case and also shows the cardiogenic shock in the patient.
Thus, the correct answer is obstructive shock.
