1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
azamat
3 years ago
10

"Linkage" refers to genes for different traits

Biology
1 answer:
Shalnov [3]3 years ago
4 0

Answer:

"Linkage" refers to genes for different traits   being located on the same chromosome

Explanation:

  • When two genes of different traits are located on the same chromosome they are said to be linked and their inheritance pattern is referred to as Linkage.
  • Linked genes tend to stay together during the formation of gametes.
  • The transmission pattern of linked genes can be complete or incomplete.
  • Complete linkage produces 0% recombinants while incomplete linkage produces  about 50% or more recombinants.

You might be interested in
Skeletal muscle is covered, surrounded and protected by various layers of connective tissue. Which layer of connective tissue wo
DENIUS [597]

Answer:

The endomysium

Explanation:

The endomysium is the connective tissue that surrounds each muscle fiber (cell)

3 0
3 years ago
What different between an animal cell and a plant cell?
Stolb23 [73]

Answer:

plant cells have a cell wall and animal cells dont

7 0
2 years ago
Read 2 more answers
Think about a carbon atom that is released into the atmosphere from burning wood in a campfire. If it were to go through the who
Vera_Pavlovna [14]

Step 1 is B ,2 is c, 3 is e, 4 is d, 5 is a

4 0
4 years ago
How do you know that the glucose molecule is a carbohydrate?
stellarik [79]
It is a carbohydrate because it is a monosaccharide. (single sugar) Simple carbohydrates also commonly end with “-ose.”
8 0
3 years ago
High level items in a wbs are broken down or _______ into smaller tasks.
Sauron [17]

High level items in a wbs are broken down or decompose into smaller tasks.

Work breakdown structure (WBS) is a chart that describes everything a project needs to achieve. Work breakdown structure is easy to understand as it organizes and breaks down complex activities into smaller levels. Each level of the work breakdown structure provides additional definition and information about the project.


6 0
3 years ago
Other questions:
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Nutrients enter a cell ______ the concentration gradient by the process of _______.
    7·1 answer
  • What determines the inherited traits an organism has?
    9·2 answers
  • How do the evolutionary chart and the video support the claim that all living things are made up of cells
    10·2 answers
  • How might the nervous system effect the vascular system
    13·1 answer
  • DNA analysis can be used to identify a person, because no two people have the same what?
    11·1 answer
  • 1. Indicate if each of the following structures is based on actin filaments (A), microtubules
    10·1 answer
  • Why are polygenic diseases less suited to gene therapy?
    7·1 answer
  • To a taxonomist a plant is the sum total of all its characteristics.<br><br> True<br> False
    7·1 answer
  • What happens when an electric charge moves?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!