1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leni [432]
3 years ago
11

Which of the following is the most abundant group of organisms on Earth?

Biology
1 answer:
zzz [600]3 years ago
6 0

It is bacteria just took the test

You might be interested in
PLEASE HELP ME WITH THIS PLEASE 10 BRAINLY POINTS!!!
finlep [7]

Answer:

18 chromosomes I guess verify

4 0
3 years ago
On which bone does Zygomatic Process occurs?
Luba_88 [7]

Answer:

Zygomatic Process occurs on temporal bone.

Explanation:

Cheek bone is formed by the zygomatic process. Zygomatic process occurs anteriorly in front of mandibular fossa and posteriorly by external acoustic measles muscle.

Temporal bone is involved in the zygomatic process. The temporal bone extends towards the sides of the skull and lies over the opening of ear. The jugal point is present on the upper side of zygomatic arch.

7 0
3 years ago
Read 2 more answers
What is the complementary strand for the following DNA segment? C A A G T T C G A T G A
Kazeer [188]

GTTCAAGCTACTGTTCAAGCTACT

6 0
3 years ago
Which of the following is an example of competition that could be found int the ocean
Elena-2011 [213]
It would be shark againts fish i think

4 0
3 years ago
Read 2 more answers
As wastes navigate the large intestine, which features do they pass through, in order?
Setler79 [48]
They waste in the large intestine pass through the villi, where bacteria and other organisms help to digest nutrients and most oftenly absorb the water content ingested. 



Thank you for your question. Please don't hesitate to ask in Brainly your queries. 
5 0
3 years ago
Other questions:
  • 3. Sarah, who has a mass of 55 kg, is riding in a car at 20 m/s. She sees a cat crossing the street and slams on the brakes! Her
    11·2 answers
  • Good mental health is the ability to __________.A.express feelings appropriatelyB.allow daily situations to cause excessive anxi
    5·2 answers
  • In facilitated diffusion, do molecules move down their concentration gradient?
    15·1 answer
  • The two members used in the construction of an aircraft fuselage are joined together using a 30° fish-mouth weld. Determine the
    15·1 answer
  • Which best describes the relationship between evolution and natural selection?
    9·2 answers
  • Please help<br> 1) What process determines the<br> potential of species to<br> increase in numbers?
    15·1 answer
  • Any one please help me on this one please
    10·1 answer
  • How exactly did life begin?
    15·2 answers
  • 10 POINTS
    11·2 answers
  • Sam was a 60-year-old man. As a result of picking up a heavy object, he fractured the radius and ulna of his right arm. X-rays i
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!