1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Andreas93 [3]
3 years ago
6

Why does darkness effect light independent reaction of photosynethesis?

Biology
1 answer:
maria [59]3 years ago
4 0
<span>Dark reactions need the NADPH synthesised in the light reaction.</span>
You might be interested in
during reabsorption of water in the proximal convoluted tubule, what causes water to diffuse from the lumen into the interstitia
castortr0y [4]

Water diffuses from the lumen into the interstitial space during the reabsorption of water in the proximal convoluted tubule due to an increase in the interstitium's osmolarity.

Reabsorption is the process by which water and solutes from the PCT are injected into the blood. From the  proximal convoluted tubule, the solutes and water go to the interstitium before entering the peritubular capillaries. The majority of the solutes and 99 percent of the water filtered by the nephron must be reabsorbed; all of these chemicals were "absorbed" in the digestive tract. The peritubular and vasa recta capillaries return reabsorbed fluids and chemicals to the circulation.

To learn more about  proximal convoluted tubule click here:

brainly.com/question/27064013

#SPJ4

5 0
1 year ago
In what 2 ways are the organisms in the table similar to organisms in the plant kingdom?
masya89 [10]

Answer:

multicellular and eukaryotes.

4 0
3 years ago
What are some pros of being a seismologist rather than being a volcanologist?
slega [8]
What are the answers given?
3 0
3 years ago
DDT is an insecticide that was used extensively in the mid-1900s to kill mosquitoes. It was very effective at first, but after a
dlinn [17]

Insect populations can develop resistance to insecticides over time. The evolution of resistance is associated with an increase in the frequency of adaptive genes in the population.

  • In the case above described it is expected that a few mosquitoes in the population were resistant to DDT before it was ever used (Option a is correct).

  • Dichlorodiphenyltrichloroethane (DDT) is a pesticide used in agriculture.

  • After exposure to DDT, those individuals in the mosquito population that didn't carry gene variants (i.e., alleles) associated with the resistance to this pesticide died.

  • Subsequently, insects having adaptive alleles associated with DDT resistance survived and reproduced, thereby increasing the frequency of adaptive genes/alleles in the population.

Learn more in:

brainly.com/question/6389591?referrer=searchResults

8 0
3 years ago
Why is cellular respiration important?
Vinvika [58]
Well I’m pretty sure it A. if we are just picking from these two because breathing doesn’t make glucose lol
7 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Hybrid inviability and hybrid infertility are two examples of:________.
    11·2 answers
  • A freshwater is a type of ecosystem. Grasses, fish, wading birds, frogs, and alligators live together in fresh water marshes. Pi
    7·2 answers
  • 2. How many substances are there in the unlabeled mixture? What were they?
    6·1 answer
  • Which form of a gene controls a trait?
    6·2 answers
  • Which statement best describes how the Great Rift Valley in Africa formed?
    8·2 answers
  • Confirm these for me please [extra characters]​
    10·1 answer
  • Which of the following is true of genetic drift?
    15·1 answer
  • What do scientists call a gavitationally bound system of two stars in which
    5·1 answer
  • Which of the following best describes the composition of a nucleotide?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!