Explanation:
(1) The conglomerate contains some nonsedimentary rock fragments. (2) The conglomerate was formed from material that was buried deep underground. (3) The conglomerate's pebbles are all weathering at the same rate.
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
6. Channel proteins span the membrane and make hydrophilic tunnels across it, allowing their target molecules to pass through by diffusion.
7. They move freely around the membrane.
8. Binary fission is the division of a single entity into two or more parts and the regeneration of those parts separate the entities resembling the original.
Ethics in research facilitates accountability of researchers and their research to the public especially in their responsibility to uphold societal values and morals. Ethics also create foundation for collaborative work between researchers by enhancing trust, respect and fairness in the field
