1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
AleksandrR [38]
3 years ago
7

which kind of reproduction is most important in maintaining homeostasis for all living things,asexual or sexual?

Biology
1 answer:
klemol [59]3 years ago
3 0
Ur Answer is: Sexual Reproduction
You might be interested in
A marine biologist wants to investigate the effect of ocean tides on certain aquatic ecosystems. Can this be studied by the scie
lutik1710 [3]
Yes it can be studied by the scientific method because it is testable and observable.
6 0
3 years ago
Read 2 more answers
K<br><br> Name the element:<br><br> Number of shells?<br><br> Valence electrons?
sergiy2304 [10]
Potassium, 4 shells, 1 valence electron
5 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Check Your Understanding<br> Question: What is an adaptation?
AleksandrR [38]

Answer:

an adaptation can be defined as an inherited trait which confers an evolutionary advantage to the organism in a certain environment

Explanation:

An adaptation, also known as an evolutionary adaptation, can be defined as any physiological and/or morphological inherited trait related to the improved evolutionary fitness of one organism in a particular environment. An adaptation improves the chances of survival and reproduction in a certain environment, thereby organisms carrying the adaptation have more chances to produce descendants and pass their genes to the next generation. Some classical examples of evolutionary adaptations include the long necks of giraffes that help them to eat leaves at the top of trees, light bones of flying birds, etc.

8 0
3 years ago
Which of the following describes research that would be considered applied science?
Nataly [62]
B is the correct answer due to the fact that applied sciences means adding to already developed technology there scientist are creating another drug to cure human diseases by mixing different elements through the process of an experiment
7 0
2 years ago
Read 2 more answers
Other questions:
  • Will anyone help me on my biology homework...? Please and thank you?
    13·1 answer
  • What were most likely the first life-forms on Earth?
    9·1 answer
  • A mother of a 7-year-old child complains to the nurse that her child wets the bed at night. upon interaction with the child, the
    10·1 answer
  • Tryptophan is an amino acid necessary for E. coli survival and growth. E. coli contain genes coding for enzymes that synthesize
    7·1 answer
  • A scientist is examining the role of an element found in fats and carbohydrates of living things. This element makes up 65% of h
    5·1 answer
  • The process by which a white blood cell engulfs, digests, and destroys a microscopic foreign invader is known a
    9·1 answer
  • What is the difference in inherited traits an organism<br> has from others of the same species.
    14·1 answer
  • An example of a density dependent limiting factor is...
    7·1 answer
  • Earth's constantly absorbs energy from the sun, yet stays at a relatively constant temperature. Explain how
    6·1 answer
  • Please help me i’ll give you brainlist
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!