I think D, because it talks about prompting more people to migrate.
Bodies of water often were used to create borders EX: in the eastern united states the states borders are rivers because it is easier than making imaginary borders
Answer:
The F u k u s h i m a nuclear accident gave ''wind in the back'' to the opponents of the production of nuclear energy because of the dangers from it.
Explanation:
Nuclear energy is produced via nuclear reactors. They are very expensive to be constructed and maintained, but the expenses are balanced very quickly because the nuclear reactors produce much more energy than any other type of facility for this purpose. It is also the cleanest and most environmentally friendly from any major type of production of energy.
Unfortunately, the production of nuclear energy doesn't come without risks. Even though very rare, accidents do happen, and when they do they cause much more damage than any other facilities for the production of energy. A more recent example is the accident in F u k u s h i m a, Japan, which resulted in a large-scale movement of people out of the area, abandoning of everything in the surroundings, and the area will not be suitable for usage for a very, very long time because of the very high levels of radiation. The opponents of nuclear energy production used this accident to make a point, especially cause it was one that happened in one of the most advanced countries, and what kind of consequences it had there, let alone if it happened in other parts of the world.
<u>Answer:</u>
Ptolemy accounted for 'retrograde motion' in his model of the solar system by introducing smaller circles named 'epicycles'.
<u>Explanation:</u>
- According to Ptolemy, the Sun and the other planets in the Solar system orbited around the Earth.
- The Greeks were convinced that Ptolemy's earlier model did not provide for backward or the retrograde motion.
- Ptolemy thought over it for a while and theorized the possibility of 'epicycles'.
- According to Ptolemy, the planets that orbited Earth also orbited another smaller point.
- The smaller orbits followed by the planets while in motion around the Earth in a larger orbit were introduced by Ptolemy as 'epicycles'.
- Until Kepler proposed his models of the functioning of the Solar system, Ptolemy's models were considered the most relevant.
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
