Answer: According to Darwin theory of evolution the struggle for existence is considered as major part for competition among living things.
Explanation:
Coexisting species that belong to the same genera compete for same kind of resources for their survival. Some phenotypic variations gives an survival advantage over others. The superior ones dominate the inferior ones and compete for resources. The one who receives the resources like mates, food, shelter, and others the chances of survival also increases considerably.
Simulations generally involve a simple design. In contrast, the world is a very complex system. Many events, such as how we farm, can disrupt the world's delicate balance. Simulations do not take into account the varied interactions that affect events in the real world.
LOCAL ENVIRONMENT ISSUE:
People dump a lot of trash in the sea, and the sea creatures living there goes through a lot of trouble to live with all the muck getting in them. Of course, don't write it like that in your assignment - you'll get told off for the straight forwardness.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
