All categories

3 years ago

Why would the guard cells have chloroplasts when the other skin cells of leaf does not have chloroplasts?

1 answer:

5 0

Chloroplasts are the tiny structures in plants cells where photosynthesis happen. chloroplasts contain chlorophyll , a green pigment that absorb light energy for photosnthesis

You might be interested in

Do cell walls manage the movement of all substances into and out of the cell?

Kisachek [45]

No, the cell membrane regulates movement of materials into and out of cells.

6 0

3 years ago

Archaea are different from bacteria in that Archaea A. have structures that are more similar to bacterial structures. B. have mo

Dmitrij [34]

A i wrong because it says that they are similar.

B is wrong because archaea are phylogenetically similar to eukaryotes

C is also true because archaea are more phylogenetically similar to eukaryotes than bacteria

D is true because the Archaea did develop before Bacteria

so your answer is C because D says that archaea are different from bacteria because the archaea domain developed first, it does not say that they are dissimilar because of their appearance

5 0

3 years ago

Obesity can lead to what disease in which there is excess sugar in the blood

marissa [1.9K]

Answer:

Explanation:

Type 2 diabetes is a disease in which blood sugar levels are above normal. High blood sugar is a major cause of heart disease, kidney disease, stroke, amputation, and blindness. In 2009, diabetes was the seventh leading cause of death in the United States.

8 0

3 years ago

Read 2 more answers

Using the picture below determine the type of mutation that has occurred.

Kazeer [188]

Answer:

Deletion

Explanation:

Deletion is the act of a gene being removed from a chromosome, making it mutated.

8 0

2 years ago

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago