Answer:
The most recent eon is subdivided into three eras and eleven periods.
Explanation:
The geological time scale has been constructed so that it can help in better research and understanding of the past, as well as making it easier to distinguish the past and its characteristics at a certain time. There are larger and smaller divisions in the geologic time scale, with the eon being the largest unit, followed by era, and then period.
The most recent eon is the Paherozoic, starting from 542 million years ago and still going on. It is subdivided into three eras and eleven periods so far. The three eras are:
- Paleozoic
- Mesozoic
- Cenozoic
The eleven periods are:
- Cambrian
- Ordovician
- Silurian
- Devonian
- Carboniferous
- Permian
- Triassic
- Jurassic
- Cretaceous
- Tertiary
- Quaternary
It would be much better if you attached picture to let me help you. Anyway, let me guess the answer. I think that it better sounds like this: The following picture shows the cycle for the production of <span>b.igneous rocks (extrusive)</span><span>.
</span>
<span>The first Europeans to come to Africa were funded by Prince Henry of Portugal. The purpose was to expand geographic knowledge, find gold, and locate Asian spices. That soon change to exporting slaves. They created a places called Elmina Castle that was originally used for trading ivory and gold but then change into for slave export. Slaves were soon capture inland over a brutal journey that resulted to half the slaves not surviving the journey. They were traded for different things like silk and beads. Soon after in became really popular for Europeans to do slave trade. Mainly because the native in America would die from disease that the European brought and most of the native fled to the other side to escape which is why European looked toward Africa for the slaves. There was a book that you could get that would help with slave trade. The book name is “An Englishman Tastes the Sweat of an African”. Slavery for with the European were more brutal than slavery in Africa. The slaves in Africa were able to marry, own property, and even own slaves themselves. It was so much better that slavery wasn't passed down generation after generation like it was done by the Europeans. Europeans ships brought 10 to 12 millions of Africans to America. There were more than 54,000 voyages back and forward from the West African coast to America. Because of these events slavery continue for more than 300 years.</span>
Well if you are adding sides to something then that makes that object HAVE to go bigger. That will affect the area. So making it bigger by forcing more sides onto a object.This way making you area getting bigger. Hope that helped. :) :) :) :).
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
